Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
There are choices for this question namely:
1. Sterile
2. Reproductive
3. Both
4. Neither
The correct answer is that flowers are a collection of reproductive tissue produced by flowering plants (angiosperms). The flower is a reproductive organ of the plant. It is composed of the male organ (stamen) which produces the pollen and the female organ (ovary) which receives the pollen. Once the ovary receives the pollen either from the same plant or from another through pollination, the ovule (part of the ovary) will then become the seed and the ovary will become the fruit. The seed is the "embryo" of the plant wherein if planted, it will grow to a new plant.
Mitosis in the stage prophase chromosome and DNA is copied
Answer:
A hydrosphere is the total amount of water on a planet. The hydrosphere includes water that is on the surface of the planet, underground, and in the air. A planet's hydrosphere can be liquid, vapor, or ice. On Earth, liquid water exists on the surface in the form of oceans, lakes and rivers.
Explanation: