1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
3 years ago
9

Messenger RNA: is found only in the cytoplasm. is the most abundant form of RNA. in all cells is initially formed as a large pre

cursor molecule called heterogeneous nuclear RNA. is the type of RNA that turns over most quickly in the cell. in eukaryotes has a 5' cap added during posttranscriptional modification.
Biology
1 answer:
eimsori [14]3 years ago
3 0
<h2>Messenger RNA</h2>

Explanation:

  • Messenger RNA (mRNA) is a solitary stranded RNA atom that relates to the hereditary arrangement of a quality and is read  by the ribosome during the time spent creating a protein
  • The three most significant strides of pre-mRNA processing are the expansion of settling and <em>signaling factors at the 5′ and 3′  ends of the molecule,</em> and the expulsion of mediating arrangements that don't indicate the <em>proper amino acids. </em>the mRNA <em>transcript can be “edited”</em>  after it is transcribed.
  • During transcription the RNA polymerase read the layout DNA strand the <em>3′→5′ way, however the mRNA is shaped in the 5′ to 3′  direction. </em>
  • The essential capacity of mRNA is to go about as a intermediary between the <em>hereditary data in DNA</em> and the amino acid sequence of proteins.
You might be interested in
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Flowers are a collection of _____ tissue produced by some plants.
Lostsunrise [7]
There are choices for this question namely:

1. Sterile
2. Reproductive
3. Both
4. Neither

The correct answer is that flowers are a collection of reproductive tissue produced by flowering plants (angiosperms). The flower is a reproductive organ of the plant. It is composed of the male organ (stamen) which produces the pollen and the female organ (ovary) which receives the pollen. Once the ovary receives the pollen either from the same plant or from another through pollination, the ovule (part of the ovary) will then become the seed and the ovary will become the fruit. The seed is the "embryo" of the plant wherein if planted, it will grow to a new plant. 
4 0
3 years ago
Read 2 more answers
In which stage of cell division is the dna copied?
Tcecarenko [31]
Mitosis in the stage prophase chromosome and DNA is copied
8 0
3 years ago
Genetic variation can aid in the survival of species when the environment changes. Which of the following is the best example of
Ymorist [56]
C)
A mouse that has learned to avoid mousetraps.
5 0
4 years ago
Read 2 more answers
The hydrosphere refers to the total amount of water on Earth, including liquid, gas, and solid forms. Which is one way the hydro
zalisa [80]

Answer:

A hydrosphere is the total amount of water on a planet. The hydrosphere includes water that is on the surface of the planet, underground, and in the air. A planet's hydrosphere can be liquid, vapor, or ice. On Earth, liquid water exists on the surface in the form of oceans, lakes and rivers.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • What happens during crossing over and what is the significance?
    10·1 answer
  • Skeletal muscle is controlled by the organism.
    11·1 answer
  • The arrows indicate the direction of wind flow. Which place experiences monsoons?
    15·2 answers
  • Name a few plant dieases caused by bacteria
    5·2 answers
  • !00 pointzzz<br> Help me nd yeahhh!! (see attachment)
    7·2 answers
  • Describe the results of three experiments that helped to show DNA is the genetic material
    5·1 answer
  • Which of the following is a true statement?
    11·1 answer
  • (03.02 MC)<br> What do weather and climate have in common?
    9·1 answer
  • All cells need to produce energy in order to survive. On prokaryotes, the energy is produced in the cytoplasm. In eukaryotes, th
    7·1 answer
  • Describe 1 factor where land affects the climate.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!