1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
2 years ago
10

What is the effect of water temperature on corals from inshore and offshore reefs?

Biology
1 answer:
frez [133]2 years ago
6 0

Answer:

When the water gets too warm, the algae can no longer live inside corals, so they leave. The corals then turn from green to white, called coral bleaching. Climate change has been causing the Earth's air and oceans to get warmer. With warmer oceans, coral bleaching is becoming more widespread.

Explanation:

You might be interested in
The rate of temperature change for the
kogti [31]

Answer:

can you explain

Explanation:

5 0
2 years ago
Radiation from the Sun heats the land during the day. A circular current of warm air rises from the land and moves out to sea, w
Alex_Xolod [135]

Answer:

D

Explanation:

6 0
3 years ago
It is a small zone inside a larger ridge called Mariana Trench
neonofarm [45]
The Challenger Deep is in the southern end of the Mariana Trench. It is estimated to be 305meters deep.
6 0
3 years ago
What were your controls for this experiment? what did they demonstrate? why was saliva included in this experiment?
Vlad1618 [11]

Positive control is Ginger root (should indicate the presence of amylase)

Negative control is Cellulose (should not contain amylase)

Here the presence of amylase is tested by testing the presence of starch using an IKI solution. Saliva is included in this experiment because it contains the enzyme amylase.

4 0
2 years ago
​Researchers believe that the size difference between male and female brains results from the influence of: a. ​gender identity.
Nesterboy [21]

Answer:

Researchers believe that the size difference between male and female brains results from the influence of:

gender identity

Explanation:

individual difference would only allow such as no published journals by researcher to affirm the obvious difference in the brain size of male and female

5 0
3 years ago
Other questions:
  • Water transportation through a plant stem is an example of?​
    13·1 answer
  • After stamping your replica plates, you return to examine the results and see that there are 100 colonies on the strep nal plate
    8·1 answer
  • Information about the composition of the earth’s interior has come from which of the following sources?
    13·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Looking at a cell under a microscope, you note that it is prokaryote. How do you know?\
    15·2 answers
  • Researchers at a university want to know if higher levels of nitrogen in fertilizer will increase the production of tomatoes per
    11·1 answer
  • What is the main function of carbohydrates?
    14·1 answer
  • Write the function of bio-catalysts/enzymes
    15·1 answer
  • What is an example of an elevation change
    10·1 answer
  • which of the macromolecules tested in this exercise (proteins, lipids, nucleic acids) were formed by dehydration reactions? expl
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!