1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalka [10]
3 years ago
11

Lichens are among the slowest-growing organisms, but their tolerance of environmental extremes enables them to colonize habitats

where few other macroscopic organisms can grow. They grow where neither the fungal partner (mycobiont) or the photosynthetic partner (photobiont) could survive alone, because they benefit from their unique symbiotic association. What mutualistic behaviors aid in the survival of both organisms?
A) The photobiont processes and provides nitrogen and carbon products to the mycobiont.
B) The photobionts are protected and able to grow in conditions in which they could not grow alone and in return release glucose in some form to the mycobiont.
C) The photobionts absorb mineral nutrients from the underlying surface or from minute traces of atmospheric contaminants while the mycobionts synthesize organic nutrients from carbon dioxide.
D) The photobionts produce ammonium and organic sodium compounds from N2 gas by sodium fixation; that in turn, aids the mycobionts in producing enzymes to decompose the substrate on which they live.
Biology
2 answers:
bekas [8.4K]3 years ago
7 0

Answer:

The correct option is B.

Explanation:

Lichens  is regarded as a mutual relationship between a mycobiont and photobiont, the relationship is targeted at enhancing their survival in extreme environments. The mycobiont is a fungal while the photobiont is usually a green alga or a mycobacterium. Each of the organism has their specific tasks; the mycobiont provides suitable habitat for the photobiont while the photobiont provide energy for the whole system.

eimsori [14]3 years ago
3 0

Answer:

The photobionts are protected and able to grow in conditions in which they could not grow alone and in return release glucose in some form to the mycobiont

Explanation:

The mycobionts help retain moisture for the algae. The algae undergo photosynthesis to produce-carbon based compounds, such as glucose, which is shared with the fungus.

You might be interested in
True or False...
erma4kov [3.2K]
Bacteria in our gut help to protect us by crowding out some of their dangerous relatives that can cause disease. Other good bacteria have been used in medicine to create antibiotics, and others still are used in food production to make fermented foods (think sauerkraut, yogurt, kimchi and kombucha.)
3 0
3 years ago
Please answer c: image attached
mafiozo [28]
The answer is c! I don’t really have much of an explanantion I just know haha
3 0
3 years ago
Read 2 more answers
A survey reveals that 25 percent of a population of 1,000 individuals have attached earlobes (are homozygous recessive for the t
Mumz [18]

Answer:

d. pxp +2pq

Explanation:

The formula for genotype frequency for a population in Hardy-Weinburg equilibrium is as under:

                           p² + 2pq + q² = 1

where, p = dominant allele

           q = recessive allele

Here,

 p² represents frequency of homozygous dominant genotype

2pq represents frequency of heterozygous genotype

q² represents frequency of homozygous recessive genotype

Also, although the genotypes p² & 2pq are different from each other yet phenotypically they both will collectively produce dominant trait i.e. free ear lobes not attached earlobes. So the term "p² + 2pq or pxp + 2pq" represents the frequency of the individuals who show the dominant phenotype in this particular population. Dominant phenotype will comprise 75% of the population.

4 0
3 years ago
A marine biologist exploring a deep sea trench locate a new species of soft-bodied creature with an unfamiliar shape he is able
Rudiy27

Answer:

It is B!!!

Explanation:

The whole quiz - because i got i believe 2 wrong cause of wrong people :/

1. C

2. D

3. B

4. C

5. C

5 0
3 years ago
Two things that Mitosis and Meiosis have in common
shutvik [7]

Answer:

Both mitosis and meiosis are multistage processes. The stages are interphase, prophase, metaphase, anaphase and telophase. The same general processes occur in each of these stages for mitosis and meiosis. Interphase is cell growth and DNA replication in preparation for cell division.

Explanation:

6 0
3 years ago
Other questions:
  • ¿que es la desnitrificacion? ¿que organismos lo llevan a cabo?
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A bacteria population triples in number each day . if there are 2,551,500 bacteria on the 7th day , how many bacteria were prese
    11·2 answers
  • Something characteristic of a survivor in the reconstitution phase of traumatic stress might be to ________.
    11·1 answer
  • Select all that apply. Which of the following factors determine conditions in a biome? population density temperature carrying c
    10·2 answers
  • In which location are you most likely to find an earthworm?
    11·1 answer
  • One main difference between a pine tree and an arctic fox is..?
    15·2 answers
  • DNA replicates by breaking the bonds between its two strands, after which each strand?
    11·1 answer
  • Hii! Please help me on this question!
    7·2 answers
  • Which statement best describes energy release in cellular respiration? (1 point)
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!