I think the answer is enzyme
Answer:
The best answer is A) A car with the engine started, but parked and idling.
Explanation:
This mean are body still breathing and pumping blood but were not aware and cant move.
-<u><em>Hope This Helps!</em></u>
<u><em>-Justin:)</em></u>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The answer is A. When a potent drug is discovered, it has to undergo animal and human trials to test it ADMET (Absorption, Distribution Metabolism, Excretion, and Toxicity) properties. Using tissue cultures to test drugs, such as cancer drugs, prevents the incidence of subjecting humans to the unknown adverse effects of the drugs before the drugs are determined to be safe for use.