1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhuklara [117]
3 years ago
15

Which of the following processes is directly affected by the cardiovascular system? hair growth muscle strength healing of cuts

hormone release
Biology
2 answers:
guapka [62]3 years ago
6 0
The cardiovascular system is indirectly responsible for all of these processes, but is directly responsible for the healing of cuts, as it delivers red blood cells to the affected area.
yanalaym [24]3 years ago
5 0
The process which is directly affected by the cardiovascular system is HEALING OF CUTS.
The human cardiovascular system is made up of the heart and the blood vessels. The heart is the major player in circulation as it is the one responsible for movement of blood round the whole body. Thus, either directly or indirectly, it affects all the processes that goes on in the body. The healing of cuts is directly affected by the cardiovascular system. Healing of cut occur in four stages and all these stages required different specific materials such as platelets, macrophages, etc that are located inside the blood. It is the responsibility of the heart to pump blood to the injured area and to delivered these needed particles to the wound site.
You might be interested in
Which one of the following scenarios accurately describes a condition in which resonance can occur? A. A column of air has a hei
deff fn [24]
C is the correct answer
3 0
3 years ago
Read 2 more answers
Which of the following is a biological catalyst?
amid [387]

I think the answer is enzyme

6 0
3 years ago
Read 2 more answers
Sleep could be best described as a __________. a. car with the engine started, but parked and idling b. truck driving on the fre
qaws [65]

Answer:

The best answer is A) A car with the engine started, but parked and idling.

Explanation:

This mean are body still breathing and pumping blood but were not aware and cant move.

-<u><em>Hope This Helps!</em></u>

<u><em>-Justin:)</em></u>

3 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Scientists use tissue cultures to study possible medicines that can be used to treat cancer patients. What is one benefit of thi
Eduardwww [97]

The answer is A. When a potent drug is discovered, it has to undergo animal and human trials to test it ADMET (Absorption, Distribution Metabolism, Excretion, and Toxicity) properties. Using tissue cultures to test drugs, such as cancer drugs, prevents the incidence of subjecting humans to the unknown adverse effects of the drugs before the drugs are determined to be safe for use.

7 0
3 years ago
Read 2 more answers
Other questions:
  • A molecule is applied to a cell and the intracellular Ca2+ concentration is found to transiently rise. You are curious to unders
    8·1 answer
  • Which statement about green plants is true?
    15·2 answers
  • When dna begins to replicate, two strands of the dna helix are separated, forming a replication bubble. at each end of the bubbl
    14·1 answer
  • Which of the following stages of regulatory control in eukaryotes largely occurs in the cytoplasm, outside of the nucleus?
    11·1 answer
  • What type of T cells tells B cells to begin producing antibodies?
    14·1 answer
  • Function of cytoplasms
    11·1 answer
  • A specialized structure within a cell that has its own specific function is known as a/an _______.
    13·1 answer
  • A county has recently evolved from under developed to developed in the birth and death rate has stabilized. This is known as
    10·1 answer
  • The primary purpose of a restriction enzyme in genetics is…
    6·2 answers
  • *
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!