1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
8

Describe and differentiate between the following heat transfer mechanisms: conduction, convection, radiation and evaporation. In

your section on radiation, describe and differentiate between radiative heat transfer between animals and other terrestrial objects, radiative heat transfer between animals, radiative heat transfer between animals and the clear night sky and radiative heat transfer between animals and the sun.
Biology
1 answer:
nydimaria [60]3 years ago
7 0

Answer:

Explanation: Radiation is divergence out from a central point, in particular evolution from an ancestral animal or plant group into a variety of new forms.

Ectotherms vs. endotherms

sun is Earth’s principal source of radiative energy. With a surface temperature of

approximately 6000K, the sun’s electromagnetic radiation transmits some of this heat in the

form of infrared radiation to our atmosphere and to varied surfaces on Earth

You might be interested in
The fusion of a _______________ and a _________________ produces a zygote with 46 (2n) chromosome number.
Nonamiya [84]

Answer:

The fusion of a egg and a sperm produces a zygote with 46 (2n) chromosome number.

3 0
3 years ago
What is a characteristic of domain archaea?
rewona [7]
One characteristic of domain archaea is their cell walls.
7 0
3 years ago
Which component of Earth's atmosphere is responsible for absorbing ultraviolet radiation? A. OZone B. Nitrogen C. Water vapor D.
djyliett [7]
A) the ozone layer, it is the one that takes the uv light from the sun
4 0
4 years ago
Read 2 more answers
Which of the following occurs during meiosis II?
morpeh [17]

Sister chromatids are separated during meiosis II because homologous chromosomes separate during meiosis I.

<h3>What is Meiosis?</h3>

Meiosis is a particular type of cell division by which gametes (germinal cells are generated) through two division cycles known as Meiosis I and Meiosis II.

During Meiosis I homologous chromosomes are separated, thereby ensuring the correct segregation of sister chromatids during Meiosis II.

In conclusion, sister chromatids are separated during meiosis II because homologous chromosomes separate during meiosis I.

Learn more about meiosis here:

brainly.com/question/8253366

#SPJ1

3 0
2 years ago
Please help me. no links I report you
UNO [17]

Answer:

c

Explanation:

because if it is constant that mean it has the same forward and backward force.

4 0
3 years ago
Other questions:
  • Which ranks the terms in order of increasing size and the number of space objects contained within?
    5·1 answer
  • In glycolysis, each molecule of glucose is broken down into two molecules of pyruvate. when this happens, most of the potential
    8·1 answer
  • Four times the sum of a number and -3 is 4 more than times the number. Write and solve and equation to find the number.
    7·2 answers
  • What type of dating method would help you determine which layer is oldest? Explain.
    13·1 answer
  • 2. Cross a homozygous two horned zork with a heterozygous two horned
    15·1 answer
  • I need the answer please
    6·2 answers
  • What is the biotic limiting factor
    13·2 answers
  • Cancer cells do not respond to signals
    12·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which two naturalists were responsible for the development of The Principle of Natural Selection?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!