1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
3 years ago
15

It is not always possible to clearly distinguish life from non-life. True or False?

Biology
2 answers:
lesantik [10]3 years ago
6 0

Answer:

False

Explanation:

The living organisms are always different from non - living organisms. The living organisms have some characters which separate them from the non-livings. These characteristics are growth, reproduction, nutrition, excretion, variations, etc. The nonliving organisms do not have these characters. Viruses are the only organisms that have both living and non- living characters. They reproduce, have genetic materials. But viruses are having a protein coat and not cell. Therefore, it is an acellular organism. It always needs a host to reproduce and in the absence of a host, they are non living microbes. Therefore, they are neither living nor non living.

Lemur [1.5K]3 years ago
4 0

I would go with false, Being life has a lively look, Non-life is well lifeless lol
You might be interested in
_________ is used by ecologists to describe the community interaction where one organism makes the environment more suitable for
Blizzard [7]

Options for the question have not been given. They are as follows:

A) parasitism

B) mutualism

C) inhibition

D) facilitation

E) commensalism

Answer:

D) facilitation

Explanation:

In ecology, facilitation is used to describe community interaction between two species in which at least one of the species is benefited. One species "facilitates" survival of another species and hence the term facilitation. They can provide facilitation by providing them refuge from predation, competition, physical stress etc.

Facilitation is broadly of two types, mutualism and commensalism. In mutualism, both the interacting organisms are benefited. In commensalism, one organism is benefited and another one is neither benefited nor harmed.

5 0
3 years ago
Name the element that has the following number of particles 26 electrons 29 neurons 26 protons
inessss [21]

the answer is iron(Fe)

7 0
2 years ago
Which of the following is most inclusive?<br> a. allele<br> b. genotype
Vikentia [17]

Answer:

The answer is Genotype.

3 0
3 years ago
Read 2 more answers
Evolution is all of the following
frosja888 [35]

♛┈⛧┈┈•༶༶•┈┈⛧┈♛♛┈⛧┈┈•༶༶•┈┈⛧┈♛

3 0
2 years ago
What classification would best an oak tree?
Rudiy27
QUESTION NUMBER ONE IS A AND FOR QUESTION NUMBER TWO IT IS  B

8 0
3 years ago
Other questions:
  • According to the phylogenetic tree, which domains are more genetically related?
    10·1 answer
  • The fetal brain begins as a long structure that develops into a variety of different structures. what does the early shape of th
    13·1 answer
  • Explain how asexual and sexual reproduction are different with emphasis or genetic diversity
    10·1 answer
  • What was the student probably trying to do?
    5·1 answer
  • Would plant seeds that store energy in oil respire faster or would plant seeds that store energy in sugar respire faster?
    9·1 answer
  • through which microscopes were cells first observed? simple microscope, tunneling microscope, compound light microscope, electro
    5·2 answers
  • What is one example of a phenotypic change that is not genetic?
    10·2 answers
  • Solar tracking, or _____, is a plant's growth toward light.
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • HELp I will mark brainlyest if correct
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!