1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sophie [7]
3 years ago
8

Which of the following is an example of specific immunity?

Biology
1 answer:
zvonat [6]3 years ago
4 0

Answer:

Immunity to Small Pox

Explanation:

Over the years, Europeans had built up an immunity to smallpox because many had contracted the disease and still survived. As the population grew children were born with some immunity to the disease. When the Europeans arrived in the Americas, and smallpox spread around the native peoples, the Europeans did not contract the disease because they were immune. However, since the natives were not immune, they slowly died of due just to the disease as well as some parts of the war between the europeans.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
When NAD+ becomes NADH, it is being
ipn [44]

NAD+ accepts a hydrogen ion (H+) and two electrons (2e−), as it becomes reduced to NADH + H+. The NADH moves to the electron transport chain and donates a pair of electrons (becomes oxidized) to the first compound in the chain.

Explanation:

5 0
3 years ago
How do plants and snails affect the CO2 and O2 gases in an aquatic environment
frez [133]

Answer:

Water plants will absorb carbon dioxide for photosynthesis, and some plants will also absorb ammonia (as a source of nitrogen for growth). Aquatic animals like fish and snails absorb oxygen and release carbon dioxide directly into water through specialized structures like gills.

Explanation:

8 0
3 years ago
What usually compresses the sedimentary rock layers?
adoni [48]

Answer:

The more sediment accumulates, the more pressure is put on the lower layers

Explanation:

8 0
3 years ago
Would the cell theory change if new information was discovered about cells today? Why or why not?
qwelly [4]

Answer:

Some parts of the cell theory would change because maybe the original one said something completely  different. so some parts of the cell theory would change like: all cells comes from preexisting cells.And It would changed to something like: All cells form all by them selves.

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Crater Lake in southern Oregon is not a crater but actually a ___.
    5·2 answers
  • Why is the action of phagocytes considered a nonspecific response?
    8·2 answers
  • Antlions can experience competition when...?
    7·2 answers
  • Which is the LEAST accurate description of glucose?
    13·2 answers
  • Idk the answer! I’ll mark brainliest whoever puts in answer within 10 minutes!!
    13·1 answer
  • Which plant-cell organelle supports and maintains the cell's shape and protects the cell Consider this plant cell. The organelle
    15·1 answer
  • Due today pls help me
    11·2 answers
  • Give a reasonable explanation as to why the energy is represented by a pyramid shape
    13·1 answer
  • Which statement best describes a characteristic unique to renewable resources?
    11·2 answers
  • An experiment is designed to examine the causes of colon cancer. All rates housed in cages maintained at 25oC, with 16 hrs of li
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!