1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
12

Which of these best explains the impact of conduction on the atmosphere?

Biology
2 answers:
Mama L [17]3 years ago
8 0

Your answer is A good Luck!

expeople1 [14]3 years ago
8 0
The answer is A ♡︎シ hope i helped
You might be interested in
What is a system of ideas that explains many related observations and is supported by a large body of evidence acquired through
Ghella [55]

Answer:

A theory.

Explanation:

A scientific theory is the product of related observations supported by evidence acquired through scientific investigation. An example of a theory includes the theory of evolution (which explains observations in the fossil record, phylogenetic patterns observed in species, and these results have been aquired through scientific investgation and analysis of things like the genome of species, and archeaological evidence)

4 0
3 years ago
One difference between plant and animal cell is that plant cells have
Hitman42 [59]

Answer:

D? Maybe

Explanation:

5 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
____ is the use of nutrients to provide energy.
antiseptic1488 [7]

Answer:

The answer is D. Digestion

8 0
3 years ago
Read 2 more answers
Lamarck's ideas on evolution were adopted by some Russian scientists, including Michurin and Lysenko in Stalinist Russia. Their
Nastasia [14]

Answer:

yes or no ok

Explanation:

4 0
3 years ago
Other questions:
  • The restriction enzymes that cut the bacteriophage DNA cannot cut the bacterial chromosomal DNA. Explain this statement. A. The
    12·1 answer
  • A flood wiping out a population would be an example of:
    15·2 answers
  • Lard is a(n)...
    12·1 answer
  • In terms of length, how does a typical bacterial cell compare to a typical eukaryotic cell?
    10·1 answer
  • "A birth in which the baby is surgically removed from the uterus, rather than traveling through the birth canal, is called"
    9·1 answer
  • What is an example of biological augmentation this is being used today?
    7·2 answers
  • Converting uranium to thorium by decreasing the number of protons from 92 to 90 and decreasing the number of neutrons from 146 t
    7·1 answer
  • During what process will carbon most likely be released?
    11·1 answer
  • Carbon atoms are the foundation of many of life's building blocks. Carbon is able to form a wide variety of different compounds
    9·1 answer
  • All enzymes are examples of which type of organic molecule?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!