1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lunna [17]
3 years ago
12

Why did the chicken cross the road​

Biology
2 answers:
galben [10]3 years ago
5 0

Answer:

to get to the other side

Explanation:

why the fk else would the chicken cross the road

matrenka [14]3 years ago
5 0
To get to the other side. obviously
You might be interested in
I will make you brainliest
dolphi86 [110]

I am going to have to say algae and fungus.

Hope this helps, if not, comment below please!!!

3 0
3 years ago
Read 2 more answers
In the dihybrid cross you performed, EeHh x EeHh, what is the probability of producing an offspring with this genotype: EEHh
ikadub [295]

The probability of producing an offspring with this genotype: EEHh is 1:1

4 0
3 years ago
The trait for red hair is recessive, meaning that when a person expresses two copies of this allele they have red hair. what can
AlekseyPX
Let "r" stand for the recessive red hair trait. A person with red hair must have a genotype of "rr" ( one from each parent) in order to have red hair( red hair being the phenotype).

Let "B" stand for brown hair and "b" stand for not brown hair. A person with brown hair can have a genotype of "Bb" or "BB" and have a phenotype of Brown hair. This is becasue brown hair "B" is the dominant trait.
5 0
3 years ago
HELPPPPP LOTS OF POINTS
ZanzabumX [31]

Answer:

B

Explanation:

its literally a cell law .-.

3 0
3 years ago
Read 2 more answers
Consider the cladogram. A cladogram is shown. Roundworms have the derived characteristics of true tissues, bilateral symmetry, a
Irina-Kira [14]

Answer:

The correct answer is - roundworms.

Explanation:

The answer is already mention in the question, however, the detailed answer is as follows:

The characteristics that are given in the question are true tissues, bilateral symmetry, and a pseudocoelom. Worms or helminths are known as primitive form of organization of the Bilaterians. All three group of worms or helmints have a basic bilateral symmetry.

These organisms inaugurated various characteristic that are found and carried by other animals such as  true tissues, bilateral symmetry, and a pseudocoelom.

Thus, the correct answer is - roundworms.

5 0
3 years ago
Other questions:
  • "the nimby syndrome presents itself when discussing"
    13·1 answer
  • What is a list of non-rodent eating snakes?<br> What is the kindest and most handle able ?
    7·2 answers
  • Explain how the movement of tectonic plates can affect local environments
    15·2 answers
  • What usually happens to radioactive waste?
    7·2 answers
  • Recognize<br> 4. What landforms are<br> common in a coastal<br> depositional environment?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • When the insulin molecule is folded where do you find leucine and isoleucine? Where do you find arginine and glutamate?
    15·1 answer
  • how the niche of trees in a temperate rainforest and the Predict niche of squirrels in the same rainforest interact.
    5·1 answer
  • Urgent!!!
    10·1 answer
  • I need help on these science thingies
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!