1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol [13]
3 years ago
11

Two species of garter snakes live in the same geographic area. One lives mainly in water and the other mainly on land; therefore

, they rarely encounter each other and do not interbreed. What type of isolation is this?
Biology
1 answer:
11111nata11111 [884]3 years ago
7 0

Answer:

The correct answer is ecological isolation.

Explanation:

The condition when two species in spite of living in the same region, exhibits certain characteristics, which inhibits them from mating with each other is termed as reproductive isolation. The obstructions or the causes that prevent them from interbreeding is known as isolating mechanisms.  

The given case is an example of ecological isolation and is one of the forms of reproductive isolation. Habitat or ecological isolation refers to the phenomenon in which two species cannot mate with each other as they thrive in two distinct locations. Like as mentioned, two species of garter snakes though coming from the same geographical area cannot interbreed, as one of them is living in the land and the other one in the water.  

You might be interested in
Regardless of cost, which biomass fuel provides the most energy?
Ostrovityanka [42]

Answer:

Wood

Explanation:

Trapped energy is <u>released</u><u> </u><u>by</u><u> </u><u>burning</u><u> </u><u>and</u><u> </u><u>can</u><u> </u><u>be</u><u> </u>converted into Biomass Energy.

so, wood would remain the largest Biomass Energy source.

Good Luck. ☺

6 0
3 years ago
Drag each tile to the correct location. The tiles can be used more than once. Megan observes four cells under a microscope and m
astraxan [27]

Answer:

The correct image with related to question is attached please do check.

Explanation:

Genetic material or Nuclear material can be found in the cell either  in "nucleus" a membrane bound organelles or found in the cytoplasm. This is the major difference between prokaryotic and eukaryotic cell.

In prokaryotic cell the genetic material that is DNA, and RNA is not present in the nucleus as there is no body like nucleus for instance figure 2 and 3 whereas in eukaryotic organisms it is present in a nucleus like in figure 1 and 4.

5 0
3 years ago
1. All honey flora are plants , but all plant are not honey Flora, Justify.​
emmasim [6.3K]

Answer:

hope it helps plz mark me brainliest ❤

Explanation:

Beekeeping is affected by adverse climatic conditions and availability of floral resources. This study aimed to survey and characterize the flora in São João do Piauí, a semi-arid region in Piauí, Brazil, and to identify species providing resources to bees. Flowering plants were observed for 18 months, and records were taken of flowering date, growth habit, visitation and resources collected by bees. Melissopalinological analysis of honey produced in the area was performed. A total of 67 flowering plant species were recorded, of which 49 were considered as bee plants, with a predominance of herbs and shrubs. The low rainfall reduces the number of flowering species, which makes important the conservation and multiplication of species which bloom in dry season, such as Ipomoea glabra, Myracrodruon urundeuva, Sida cordifolia and Ziziphus joazeiro, as well as species that contribute to honey production such as Mimosa tenuiflora, Mesosphaerum suaveolens and Croton sonderianus.

3 0
3 years ago
Which statement best illustrates why carbon is so important to living things? Carbon occurs as a solid, a liquid, and a gas. Car
Fiesta28 [93]

Answer;

D.Carbon-based macromolecules are found in all life forms.

Explanation;

-Most molecules that make up living things are based on carbon atoms. The structure of a carbon atom allows it to form up to four covalent bonds. It can bond to other carbons or to different atoms.

-All organisms are made of four types of carbon-based molecules; carbohydrates, lipids, proteins, and nucleic acids. Carbohydrates are molecules made of carbon, hydrogen, and oxygen. Sugars and starches are both types of carbohydrates. These carbohydrates can be broken down to produce energy in cells. Some carbohydrates are part of cell structure in plants.

-Lipids are molecules that include fats, oils, and cholesterol. Lipids are nonpolar, so they do not dissolve in water. Like carbohydrates, most lipids are made of carbon, oxygen, and hydrogen atoms. Some lipids are broken down and used as energy in cells.

-Proteins are the most varied of the carbon-based molecules in organisms. There are many different types of proteins. They are involved in many different body functions including movement, eyesight, and digestion.

5 0
4 years ago
Read 2 more answers
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
Other questions:
  • Theories are ideas that scientist are most certain about true or false
    9·2 answers
  • Rapid melting of the Antarctic ice sheet would have the immediate effect of _____. folding the Antarctic crust
    12·2 answers
  • Using the evolutionary tree, match each plant group to a trait that it possesses. Each trait label can only be used once.
    12·1 answer
  • What do chinchillas take baths in?<br> A.Water<br> B.Mud<br> C.Volcanic Ash<br> D.Nothing
    13·1 answer
  • Which of the following is an example of anatomy?
    13·1 answer
  • During the 1900s, the following genetic discoveries were made:
    13·1 answer
  • For the Rock Pocket Mouse, what accounts for the difference in the color of the environment?
    6·1 answer
  • What is the name of the chemical messenger molecule which travels from one neuron across the synaptic gap to allow the impulse t
    12·2 answers
  • Which macromolecule is considered the major component of the cell membrane?
    7·2 answers
  • All viruses rely on<br> friends<br><br> themselves<br><br> a host<br><br> the weather
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!