Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Water evaporates from the ocean and land surfaces, is held temporarily as vapour in the atmosphere, and falls back to Earth's surface as precipitation. ... Water that infiltrates Earth's surface becomes groundwater, slowly seeping downward into extensive layers of porous soil and rock called aquifers.
Answer:
A=T is the answer ..............