1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
3 years ago
5

Pls someone help me on this one pls to again

Biology
1 answer:
umka2103 [35]3 years ago
4 0
I think it’s the first but I am not for sure take a guess
You might be interested in
How does coal create a negative impact to the environment?
telo118 [61]
Coal creates a negative impact on the environment because it contains sulfur and other harmful elements. When you burn coal these elements are then released into the air. And it can cause air pollution and health dangers as it releases a lot of carbon dioxide. 
5 0
3 years ago
Why does an egg change color and texture when heated? Its proteins reorder their sequence of amino acids. Its pH increases, whic
pickupchik [31]
The reason why an egg texture when heated is because : Proteins lose their shape and become insoluble
This occurrence is commonly known as denaturation, which caused the bond that bind the amino acid to break during the heating process and form another bond.<span />
4 0
2 years ago
What term is used to describe a representation of a thing or system and can be used as a way to test hypotheses
MAXImum [283]
The answer is model :)
3 0
3 years ago
X-rays are used during all of the following tests except
notka56 [123]

Answer:

The answer is B

Explanation:

because magnetic resonance imaging is a form of medical imaging that measures the response of the atomic nuclei of body tissues to high-frequency radio waves when placed in a strong magnetic field, and that produces images of the internal organs.

4 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Other questions:
  • What is a benefit of using nonrenewable resources? (2 points)
    7·1 answer
  • Which of the following would be the SI unit to use in measuring the amount of electrical current in a circuit?
    12·2 answers
  • Autotrophic organisms require other organisms to produce their own food.<br><br> True ot false.
    6·2 answers
  • *GIVING BRAINLIEST. PLEASE HELP<br><br> Q: What trend in the monarch population does the graph show?
    14·1 answer
  • I need help!!! Please!!!!!
    10·1 answer
  • Which 'if any' of the following are true? Aquatic animals present a greater risk to divers than any other factor. Most aquatic a
    15·1 answer
  • Infer: In which part of Earth's core do<br> convection currents occur?
    7·1 answer
  • Enter the correct 4 digit code (no spaces) *<br><br> This is a required question
    6·1 answer
  • The image shows two cups that are each placed upside down in a bowl with water. The bowl on the left has hot water and the bowl
    11·1 answer
  • Which of these is true of every ecosystem on Earth?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!