1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kari74 [83]
3 years ago
14

Which conclusion may be made when comparing fossils in undisturbed strata of sedimentary rock?

Biology
1 answer:
Klio2033 [76]3 years ago
4 0
When comparing fossils found in undisturbed layers of ground the most common conclusion is the age of the fossils. More specifically, in this way can be seen the time period in which the fossils found were living, and also the approximate age of them. By comparing them, can be seen the evolution of them, and what has caused it.
You might be interested in
Write the three principles of the cell theory. ASAP
goldenfox [79]

Answer:

The three tenets to the cell theory are as described below: All living organisms are composed of one or more cells. The cell is the basic unit of structure and organization in organisms. Cells arise from pre-existing cells.

5 0
3 years ago
Use the following information to answer the following question below. Moss invades and establishes itself on bare rock, accumula
umka21 [38]

Answer:

Primary succession.

Explanation:

Ecological succession refers to the changes involved in the species structure of a community that is established in a particular habitat over time. The succession is of two types: the primary succession and secondary succession.

When the succession takes place on the barren land then succession is considered primary succession.

In the given question, the moss invades and colonizes the rocks and breaks them into the soil. Here the moss species is known as the pioneer species and since the moss grows on the barren rock, therefore, is considered the primary succession.

Thus, primary succession is correct.

7 0
3 years ago
Three genes on the same chromosome have the following rates of recombination: · T – K = 10.5 percent · A – K =12.5 percent · A –
Nadusha1986 [10]
The correct order of the genes on the chromosome is A,T,K 
4 0
3 years ago
Read 2 more answers
What is the function of the small intestines?
Ira Lisetskai [31]

Answer:

to absorb water

Explanation:

8 0
2 years ago
Read 2 more answers
Which organelle is the powerhouse of the cell, the site of cellular respiration?
rusak2 [61]
D. The mitochondria of the eukaryotic cells are the sites of cellular respiration and where most of the steps take place. Cellular respiration allows for the release of energy stored in chemical bonds of glucose (obtained from food) to form adenosine triphosphate, which is the energy currency of the cell.
8 0
3 years ago
Read 2 more answers
Other questions:
  • What factors can change the dissolving rate of solution ?
    6·1 answer
  • (100 POINTS!!!) PLEASE HELP QUICK!!!
    12·2 answers
  • The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
    14·1 answer
  • What is the maximum number of degrees of longitude possible
    11·2 answers
  • Why is it impossible for unicellular organisms to use meiosis?
    7·1 answer
  • Level Two Questions:<br> 16. How does the diaphragm help to bring air into the lungs?
    14·1 answer
  • Heat can transfer between two objects touching one another. What type of heat transfer is this? What will the temperature of bot
    10·1 answer
  • Heather presented to her class a report about the pancreas. Which statement in Heather’s report was not accurate?
    11·2 answers
  • Please answer asap due in 10 mins giving brainiest
    14·2 answers
  • Evolutionary relationships between organisms are determined by.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!