1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sineoko [7]
3 years ago
15

what would be an advantage of using totipotent cells instead of pluripotent cells for medical treatments?

Biology
2 answers:
garik1379 [7]3 years ago
7 0

Answer:

Totipotent cells can differentiate into more types of cells

Explanation:

Apex

Rashid [163]3 years ago
5 0
Totipotent cells can differentiate into more types of cells
You might be interested in
How do ecologists measure population density?
Anni [7]
They divide the amount of people by square miles
7 0
3 years ago
Read 2 more answers
What process formed this delta?
solong [7]

Answer:

I think A

Explanation:

because erosion is the washing away of soil

3 0
3 years ago
The cell cycle must be regulated in a multicellular organ in order toA. maintain the proper cell number in tissuesB.activate cel
Lapatulllka [165]

Answer:

E. All of the above

Explanation:

The cell cycle refers to the orderly series of events that make new daughter cells by dividing the existing cells. The cell cycle is required to produce new cells during growth and development, to replace the old and damaged cells, and to repair the tissue by adding the new cells. If the existing cells do not enter the cell cycle, new cells would not be formed to be added to the tissues of the organisms.

However, the cell cycle is regulated at several checkpoints to ensure that a cell enters the process only when the new cells are required by the body and the process is stopped once the required number of new cells are formed. Any deviation from the regulation of the cell cycle may make the cells to enter the uncontrolled cell division. It may even lead to cancer where the cells divide without any control and produce malignant tumors.

6 0
4 years ago
Help please the number 2. And 3.
HACTEHA [7]
Herbivores have flat teeth because that helps them chew plants easier. 
Omnivores have both sharp and flat teeth because they eat both meat and plants, so they need both types
4 0
3 years ago
Read 2 more answers
Which number in the diagram represents a landform made by the deposition of sediments.
gogolik [260]
B)landform 2 is what was made by the deposition of sediments
4 0
3 years ago
Other questions:
  • 20. Explain how health care professionals treat unregulated (or abnormal) cellular growth in the body
    9·1 answer
  • In cells, _______ of the chemical energy in a metabolized glucose molecule is used for atp production and the rest is released a
    7·1 answer
  • How might a homogeneous gene pool make the endangered cheetah more susceptible to extinction?
    15·2 answers
  • John and Jennifer have just gotten married. John has blood type B and Jennifer has blood type O. John’s father has blood type B
    14·1 answer
  • How do cells regulate the activity of the enzymes?
    7·1 answer
  • Select all the following that describe isotopes of an element
    6·1 answer
  • Need help ASAP with this usatestprep question!
    6·1 answer
  • 2. What do wombats eat? When do they eat? (hint: nocturnal)
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Is it a carbohydrate, lipid, protein, or nucleic acid?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!