The correct answer is letter C. Dendrites <u>receive information from other neurons or from the external environment.</u> Dendrites are part of the neurons that are responsible for receiving information from the axon and the synapses that occur within the Central and Peripheral Nervous System. These dendrites branch off into multiple other synapses in order for the body to create a long chain of nerve impulses.<u />
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
c) allowing an organism to adjust to changes in environmental conditions
Explanation:
A stimulus can be defined as any change in the external or internal environment that produces a corresponding response in the organism. These responses enable the organism to maintain an internal equilibrium (homeostasis). Gene expression in prokaryotes, which are the simplest forms of life, is highly regulated by environmental stimuli. Some examples of stimuli known to regulate gene expression patterns in prokaryotic organisms are light, water, pressure, temperature, etc.
uterus It passes through the fallopian tube into the uterus, where it attaches to the uterine wall. The placenta, which will nourish the baby, also starts to form.
