1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zaharov [31]
3 years ago
12

Which term describes an inherited or innate trait that allows an organism to survive in its particular environment?

Biology
1 answer:
Semmy [17]3 years ago
3 0
It is C. adaptation.. usa test prep

You might be interested in
List at least 2 variables that affect the rate of enzymes
USPshnik [31]

Knowledge of basic enzyme kinetic theory is important in enzyme analysis in order both to understand the basic enzymatic mechanism and to select a method for enzyme analysis. The conditions selected to measure the activity of an enzyme would not be the same as those selected to measure the concentration of its substrate. Several factors affect the rate at which enzymatic reactions proceed - temperature, pH, enzyme concentration, substrate concentration, and the presence of any inhibitors or activators.



Hope this helps!<3


5 0
3 years ago
In general, what causes a land breeze?
Alex Ar [27]

Answer:

The difference in specific heat capacity between land and water

Explanation:

(A P E X)

3 0
3 years ago
1.What is the difference between spoils and tailings?
Vinvika [58]
<span>The difference is where the material came from. Spoils come from overburden and is discarded as waste, whereas, tailings come from left over dredging of steam beds that are discarded as waste as well. </span>
8 0
3 years ago
Read 2 more answers
The Sabi Sands lion population is composed of lions that were relocated from other parts of Africa.
IgorC [24]

wow thanks for the info

5 0
3 years ago
PLEASE ITS URGENT!<br> Can someone help me name them!
zloy xaker [14]

Answer:

i filled the thing out for you. i didnt know what grade you were in so i just put the cell names in.

Explanation:

4 0
3 years ago
Other questions:
  • Which include the male and female sex cells?<br> gametes<br> chromosomes<br> eukaryotes<br> diploids
    14·2 answers
  • Which of the following can reduce biodiversity within a natural environment?
    11·2 answers
  • As a cell grows, what happens to its surface area to volume ratio? (hint: think of a balloon being blown up). how does this rati
    13·1 answer
  • Why might a point mutation in dna make a difference in the level of a protein's activity? why might a point mutation in dna make
    12·1 answer
  • Which of the following statments correctly describes the difference between plant cells and animal cell
    5·1 answer
  • What are some of the ways that parasites have adapted to transmission between hosts and resisting the host’s attempts to get rid
    5·1 answer
  • Describe the basic storage mechanism for DNA using the words histone complex, nucleosome, chromatin and chromosome.
    10·1 answer
  • Explain how birth rate, immigration, death rate, and emigration affect population growth.
    15·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • How are water resources used and managed?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!