1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zaharov [31]
3 years ago
12

Which term describes an inherited or innate trait that allows an organism to survive in its particular environment?

Biology
1 answer:
Semmy [17]3 years ago
3 0
It is C. adaptation.. usa test prep

You might be interested in
Dendrites:
Anuta_ua [19.1K]
The correct answer is letter C. Dendrites <u>receive information from other neurons or from the external environment.</u> Dendrites are part of the neurons that are responsible for receiving information from the axon and the synapses that occur within the Central and Peripheral Nervous System. These dendrites branch off into multiple other synapses in order for the body to create a long chain of nerve impulses.<u />
3 0
3 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Prokaryote's ability to regulate patterns of gene expression most likely promotes the organism's survival by ________.a) allowin
Olin [163]

Answer:

c) allowing an organism to adjust to changes in environmental conditions

Explanation:

A stimulus can be defined as any change in the external or internal environment that produces a corresponding response in the organism. These responses enable the organism to maintain an internal equilibrium (homeostasis). Gene expression in prokaryotes, which are the simplest forms of life, is highly regulated by environmental stimuli. Some examples of stimuli known to regulate gene expression patterns in prokaryotic organisms are light, water, pressure, temperature, etc.

3 0
3 years ago
Anyone know the answer?
Viktor [21]
 uterus It passes through the fallopian tube into the uterus, where it attaches to the uterine wall. The placenta, which will nourish the baby, also starts to form. 
3 0
4 years ago
Read 2 more answers
if a cow that produces large quantities of milk is bred with a bull whose mother also produced large quantities of milk,what wou
bija089 [108]
To produce large quantity of milk
3 0
3 years ago
Other questions:
  • How many golgi bodies are in a plant cell?
    13·1 answer
  • What health-care system was founded by andrew taylor still, an allopathic physician who disliked the toxic drugs of his time?
    15·2 answers
  • The nurse is teaching the client newly diagnosed with systemic lupus erythematous about the condition. Which statement by the cl
    14·1 answer
  • If a polynomial function f(x) has roots 4-13i and 5, the factor of f(x) must be_______.
    9·2 answers
  • Vein
    8·1 answer
  • Which category of environmental worldview do you think would be most likely to lead to a sustainable future if it were widely ac
    15·1 answer
  • When added to water, how does an acid affect the pH and H+ concentration
    10·1 answer
  • Which of the following is NOT a derived unit?<br> O A) m<br> OB) g/mL<br> O C) cm3<br> OD) dm3
    14·2 answers
  • Which of the following is a cause of a DNA mutation?
    11·1 answer
  • Which function of the urinary system leads to the elimination of excessive substances in the urine, such as sodium and potassium
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!