1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
5

How does the immune system work together with the circulatory system to function properly?

Biology
2 answers:
enot [183]3 years ago
6 0


The correct is actually D , this is a question I have reviewed before in the past and the correct answer is def D as I remember clearly , I forgot how I explained it but I know for sure the answer is D :)

Have a merry Christmas !

Inga [223]3 years ago
4 0
The answer is probably B because white blood cells are part of the immune system, so help to fight diseases. The circulatory system helps to move the white blood cell around the body. Also, pathogens are disease causing organisms, and as you can see, they all relate very well. Hope i helped, have a nice day. 
You might be interested in
Explain the structure of a mosquito briefly.​
valina [46]

Answer:

Mosquitoes have thin, long bodies and three pairs of extremely long legs. They have scales along the veins of their wings and long beak-like, sharp sucking mouth parts called a proboscis. These two features distinguish mosquitoes from other flies. Mosquitoes also have feathery or hairy antennae.

8 0
3 years ago
Read 2 more answers
Why is it important to pursue the use of renewable resources?
Snezhnost [94]
Renewable energy provides reliable power supplies and fuel diversification, which enhance energy security and lower risk of fuel spills while reducing the need for imported fuels. Renewable energy also helps conserve the nation's natural resources.
3 0
3 years ago
Which of these is responsible for initiating a signal transduction pathway? which of these is responsible for initiating a signa
Iteru [2.4K]
A single molecule is the one that is responsible for initiating a signal transduction pathway. The answer in this question is a single molecule. Molecule is defined as an electrically neutral group of two atoms or more held together by a chemical bonds.
7 0
3 years ago
A ____ is a chemical substance that organisms require to live.
Fittoniya [83]

Answer:

Nutrients makes the most sense.

7 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Adrenergic synapses release the neurotransmitter in the
    10·1 answer
  • Scientists discovered a fossilized cockroach trapped in amber, which was supposed to be about 50 million years old. DNA fingerpr
    5·2 answers
  • One class of pollutants that can cause excessive growth of algae is
    6·1 answer
  • 1. Which vertebral range does the cervical enlargement exist in? Lumbar enlargement? 2. What structure contains the neurons that
    13·1 answer
  • The vagina divides in two_________
    6·1 answer
  • What are the characteristics of annelidas
    7·1 answer
  • The mouse population would most likely decrease if there were?
    12·1 answer
  • Which traits do you think are very strictly determined by your genetic make-up (genotype)?
    6·1 answer
  • In general, when recombination experiments are conducted with bacteria, participating bacteria are mixed in complete medium, the
    5·1 answer
  • In certain species of plants, purple flowers (P) are dominant to white flowers (p). If two heterozygous plants are crossed, what
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!