1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
3 years ago
14

What is one between a drup and a berry

Biology
1 answer:
adoni [48]3 years ago
6 0

a drupe has usually only one seed but berries are characterized as having flesh endocarp and might have more than one seed hope this helps (if this is what u meant) also a drupe is a accessory fruit while a berry is a multiple fruit.

You might be interested in
Describe the relationship between the reactants and products of photosynthesis and cellular respiration.
Leni [432]
The reactants of photosynthesis are carbon dioxide and water, meaning during photosynthesis carbon dioxide and water are taken in to create energy. The reactants of cellular respiration are glucose (sugar) and oxygen, these are taken in by animals and humans to produce energy.
-
-
-
-
Explanation:
The end products of Photosynthesis are starting products(reactants) of Respiration.
End products of Respiration are starting products(reactants) of Photosynthesis
7 0
3 years ago
What male reproductive gland is missing in the cat
Vika [28.1K]

Answer:

Seminal vesicles

Explanation:

The seminal vesicles also called vesicular glands are found only in some mammals. Those are paired  tubular glands within the pelvis with the function to secrete fluid that will become the semen.

Male cat does not have a seminal vesicle, but do have other accessory glands that secrete the seminal fluid such as prostate gland and Cowper´s (bulbourethral) glands.

7 0
3 years ago
Help!--Alice did an experiment to find the relationship between the angle at which a ray of light strikes a mirror and the angle
Molodets [167]
The answer should be A.
The control variable is the experimental variable that remains unchanged throughout the experiment. Alice did change the angles where the light from the ray box struck the mirror and where the mirror reflected the light. She also changed the direction, but she never really changed the ray box.
4 0
4 years ago
Read 2 more answers
What atoms are found in all carbohydrates?
Elza [17]

Hey There,

The answer to your question is:

Carbon, Hydrogen and Oxygen

All carbohydrates (carbs) contain these three elements.


Best Of Luck,

- Kai -

7 0
3 years ago
What is the importantance of DNA replication to all living organism
Lady_Fox [76]
Explanation:
The information stored in the DNA is essential for life. If a cell dies the body must replace that cell. The only way to replace the cells is to first copy the information that the cell contained. There is a complex system of proteins and enzymes that unravel the DNA double helix so that the DNA can be copied.
If a single cell dies it can be replaced through mitosis. The two daughter cells are identical to the original cell whose DNA was copied. This system works well with single cell and simple organisms.
3 0
3 years ago
Other questions:
  • A marine biologist exploring a deep sea trench locate a new species of soft-bodied creature with an unfamiliar shape he is able
    12·1 answer
  • Blood cells are made in which system? A. muscular system B. skeletal system C. circulatory system D. digestive system
    15·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What was the Catholic Church’s response to the Reformation? A. the Pre-Reformation B. the Peace of Augsburg C. the Counter-Refor
    7·2 answers
  • In __________ contraction the amount of tension increases during contraction, but the length of the muscle does not change.
    8·1 answer
  • What is the special way of living that an organism has in a community?
    10·1 answer
  • Jane uproots a beetroot plant from the soil. She observes that the edible bulb of the plant is located beneath the soil, and the
    10·2 answers
  • Harry had been learning about joints in one of his classes at school. On the way to the emergency room he tried to recall what t
    13·1 answer
  • PLEASE HELP!!!! :(
    11·2 answers
  • If a linear piece of dna has three sites for a particular restriction enzyme, into how many fragments will that restriction enzy
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!