Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
unicellular - both prokaryotes and eukaryotes
contain mitochondrion - eukaryotes only
are generally less than 2 pm - Prokaryotes only
multicellular - eukaryotes only
lack membrane-bound organelles - prokaryotes only
Explanation:
Prokaryotes are generally unicellular, that is, they are made up of single cells only. However, there are unicellular and multicellular eukaryotes with some eukaryotes like humans and advanced plants having as many as millions of cells.
Prokaryotes generally lack nucleus and other membrane-bound organelles such as chloroplast and mitochondrion. Eukaryotes on the other hand have nucleus and membrane-bound organelles such as mitochondrion and chloroplast.
When it comes to size, prokaryotes are generally small and microscopic while eukaryotes consist of both microscopic and macroscopic cells or organisms. However, prokaryotes are generally smaller than microscopic eukaryotes.
Scissors change the magnitude or direction of a force without any motor.