1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ser-zykov [4K]
2 years ago
5

What makes an energy source renewable?

Biology
1 answer:
AleksAgata [21]2 years ago
5 0
Clean energy like solar wind and water
You might be interested in
Select the correct answer.
marshall27 [118]

Answer:

The answer is C

Explanation:

8 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Classify each statement based on whether it describes prokaryotes only, eukaryotes only, or can describe both prokaryotes and eu
Phantasy [73]

Answer:

unicellular - both prokaryotes and eukaryotes

contain mitochondrion - eukaryotes only

are generally less than 2 pm - Prokaryotes only

multicellular - eukaryotes only

lack membrane-bound organelles - prokaryotes only

Explanation:

Prokaryotes are generally unicellular, that is, they are made up of single cells only. However, there are unicellular and multicellular eukaryotes with some eukaryotes like humans and advanced plants having as many as millions of cells.

Prokaryotes generally lack nucleus and other membrane-bound organelles such as chloroplast and mitochondrion. Eukaryotes on the other hand have nucleus and membrane-bound organelles such as mitochondrion and chloroplast.

When it comes to size, prokaryotes are generally small and microscopic while eukaryotes consist of both microscopic and macroscopic cells or organisms. However, prokaryotes are generally smaller than microscopic eukaryotes.

7 0
2 years ago
What is An aquatic animal that makes protein based slime
Darina [25.2K]

Answer:

a hagfish!

Explanation:

8 0
3 years ago
Read 2 more answers
Scissors are considered a compound machine because ____________.
Pie
Scissors change the magnitude or direction of a force without any motor.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Suppose that a patient is diagnosed with a new disease caused by the buildup of waste material in the body’s cells. Which organe
    15·2 answers
  • Reactants capable of interacting to form products in a chemical reaction must first overcome a thermodynamic barrier known as th
    13·2 answers
  • The major source of building blocks for building new muscle and tissue are found in foods that contain ____.
    12·1 answer
  • I'm a bit stuck on this question,,, i'll be sure to give brainliest!
    12·1 answer
  • Qué pasa si no se lleva a cabo la citocinesis después de la mitosis?!!!
    11·1 answer
  • What is the relationship between the bud and the parent
    14·2 answers
  • Why does sexual reproduction increase the genetic variation in a species?
    11·2 answers
  • if u bark at other people while losing an argument ur dumb i cant say other words brainly wont let me
    15·1 answer
  • Many whales have tiny, unused hip and pelvis bones known as vestigial organs. How does this evidence support theories about anim
    15·2 answers
  • The use of dna information to direct the production of particular proteins is called
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!