1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena55 [62]
2 years ago
10

If the bacterium staphylococcus aureus experiences a cost for maintaining one or more antibiotic-resistance genes, then what sho

uld happen in environments from which antibiotics are missing
Biology
1 answer:
djyliett [7]2 years ago
4 0
The bacteria must be outcompeted and substituted by bacteria that have gone this genetic factor. In addition, antibiotic resistance is a natural phenomenon.  Once an antibiotic is used, bacteria that can fight that antibiotic have a greater chance of existence than those that are vulnerable. The vulnerable bacteria are exterminated or inhibited by an antibiotic, subsequent to a selective weight for the existence of resilient tensions of bacteria. Around opposition happens without human deed as bacteria can yield and use antibiotics in contradiction of other microorganisms, prominent to a low-level of the natural assortment of opposition to antibiotics. Though, the presently advanced points of antibiotic resilient bacteria are credited to the abuse and abuse of antibiotics. 
You might be interested in
The __________ nervous system mobilizes the body when one needs to exert tremendous energy (such as flee from an attacker).
hichkok12 [17]
The central nervous system
6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Which of the following statements is true? Viruses do not cause communicable diseases. Vaccines are 100 percent effective in pre
Sergeeva-Olga [200]
Diseases can be spread from doorknobs
5 0
3 years ago
Read 2 more answers
Which trait is heterozygous?<br> A- Aa<br> B- aa<br> C- AA
Nataly [62]

Answer:

A.) Aa

Explanation:

A heterozygous gene is known as having two different alleles of a particular gene or genes. The correct answer is option A because both letters are different, versus the other two options where both are capital or lowercase.

6 0
2 years ago
Read 2 more answers
The ultimate purpose of respiration:
pshichka [43]

Answer:

if ur asking which one of those answer choices is the right one, it's D! Deliver oxygen to every blood cell <3

Explanation:

This involves transport of oxygen from the lung to the tissues by means of the circulation of blood.

7 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following is a function of carbohydartes
    12·1 answer
  • A membrane protein is made and inserted into the membrane of the rough endoplasmic reticulum. A binding site that is present in
    13·1 answer
  • After a zygote is formed, specialization of cells occurs. Through which process do the cells of a zygote become specialized?
    9·1 answer
  • What is biodiversity?
    15·1 answer
  • What is the function of the cebtrosome and centioles in the cell during mitosis
    7·1 answer
  • PLZZZ HRRRY AND ANSWER ASAP WILL MARK AS BRAINLEST
    6·1 answer
  • a rocket launched 200 kilometers in 40 seconds what is the avarage spped of the rocket in kilometers per hour?​
    5·1 answer
  • Female spiders only mate when a male of the same species taps her web in a particular way. This is an example of:
    14·1 answer
  • How many combinations of A, C, G, and U exist? Include an equation
    13·1 answer
  • When an invasive species is introduced into a new habitat where it has no natural predators, it can quickly populate. Which best
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!