Answer:
D. sodium, nitrogen, oxygen
Explanation:
Let's break up NaNO3 into its separate chemical symbols:
Na, N, O
Na is the symbol for sodium
N is the symbol for nitrogen
O is the symbol oxygen
Hi
First of all we need to understand what are shared derived characteristics or synapomorphies. These are the characters which were evolved in the ancestors of special groups of organisms and after that they were transferred to the descendants (or lineages) of those groups as well.
These characters are very important in the grouping or organisms. Now coming towards the question, we see there is a cross between Fungi and Plantae.
<u>The shared derived character that can be written here will be multicellular and eukaryotes</u><u>. </u>
These are the characters which were evolved in both fungi and protists from their immediate ancestors and are transfrred to their further lineages as well.
Hope it help!
Answer:
Nonsense mutations
Explanation:
Premature termination of translation is caused by Nonsense mutations.
It's at mutation that occurs in the mRNA when a stop codon is produced through substitution, insertion or deletion within the region that encodes the polypeptide in the wild‑type mRNA.
Answer:
TTAACGCTAGCGAGCATGGCC
Explanation:
A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.
Simple carbohydrate contain 1 or 2 sugar chain that have the most basic structure our body need. For eg glucose. Complex contain 3 or more sugar groups. These are refer to as starchy. These stay I our body longer. For rg brown sugar
