1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
8

What is stripped from each water molecule

Biology
2 answers:
Iteru [2.4K]3 years ago
8 0
The HS is stripped from each O

matrenka [14]3 years ago
6 0
Thats right hs is stripped from each water molicule
You might be interested in
What do I put in number 4???????? HELP​
Vaselesa [24]

human karyotype

yan yung sagot

5 0
2 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
A pre-purchase inspection differs from a pre-sale inspection in that
Anastaziya [24]
A pre-purchase inspection differs from a pre-sale inspection in that a. it's requested by the home buyer rather than the seller. B. the inspection report can be used as evidence in court. C. clients are unable to negotiate the conditions of the sale.
5 0
3 years ago
Free 100 points for nice people
Bingel [31]

Answer:

How do you put a giraffe into the fridge

How do you put an elephant into the fridge

Explanation:

4 0
3 years ago
Read 2 more answers
Which nims command and coordination structures are offsite locations where staff from multiple agencies come together? answer ic
ivolga24 [154]

Emergency Operations Centers (EOCs) are the National Incident Management System (NIMS) command and coordination structures that are offsite locations where staff from multiple agencies come together.

Emergency operations center (EOC) is a control facility that functions mainly for incident response. This center serves as a central intelligence arena where response team personnel and decision makers gather and analyze extremely important information, organize response activities, make decisions that guards life and property, communicates with staff and response team personnel and ensure the consistent existence and operation of the organization.


4 0
3 years ago
Other questions:
  • Blank is producing plants for beauty
    13·1 answer
  • What systems contain the heart
    15·2 answers
  • Betty, 66 years old, is in great physical shape. she works out at the gym every day, and recently her doctor told her she is in
    15·1 answer
  • PLEASE HELP ME!!!!!
    15·1 answer
  • What role do surface properties play in determining the lifespan of a flu virus?
    13·1 answer
  • Which is a monomer of a protein?
    10·2 answers
  • Explain why human eggs all contain one X chromosome
    15·1 answer
  • Someone please help me I will mark you BRAINLIST I need help with all 6 questions please
    15·1 answer
  • Which of the following body cavities contains the urinary bladder?
    10·2 answers
  • 50 POINTS!!!! Which result is a predicted result of the melting of the world's ice sheets?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!