1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
10

What are the characteristics of asexual reproduction??

Biology
1 answer:
Artemon [7]3 years ago
5 0
In asexual reproduction, there is only 'one' parent
You might be interested in
The wall of the alveolus (air sac) in the lung is composed of which type of epithelium?
lesantik [10]
Psuedostratified columnar epithelium
5 0
3 years ago
When one DNA molecule is replicated, the result is two DNA molecules. What is true of the second DNA molecule?
soldi70 [24.7K]
<span>It is identical or nearly identical to the first DNA molecule.</span>
6 0
3 years ago
How does a nervous impulse begin
Yakvenalex [24]
It begins with a change in the charge of voltages found in something called axon walls. 
8 0
3 years ago
Read 2 more answers
Any fracture or system of fractures along which earth movements Is known as?
777dan777 [17]
<span>rocks undergo this when stress builds up past a certain point, called the ... is any fracture or system of fracture or system of fractures along which earth ... the fracture is caused by horizontal shear and movement is mainly horizontal </span><span>many kind of rocks that make up Earth's crust fail when stress is applied too quickly ... The resulting fracture or system of fractures along which movement occurs.</span>
4 0
3 years ago
Please help quickly i will give a thanks you will get all the points and brainliest with 5 stars​
uranmaximum [27]
Might be c. Parasitism!
6 0
3 years ago
Other questions:
  • Where are most earthquakes found? in the middle of continents under the ocean only along plate boundaries along the equator
    15·2 answers
  • 2. A man with type B blood marries a woman with type A blood. Their first child has type o blood. The couple says this is
    8·2 answers
  • If an abnormal rearrangement or alignment of the bones results from a fracture, it is called a __________ fracture.
    9·2 answers
  • Vibrio cholerae produces a toxin that binds to a plasma membrane receptor on intestinal cells of the host. The toxin permanently
    10·1 answer
  • Which of the following is NOT true regarding the members of a protein family in general?a. They have similar three-dimensional c
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Carbon dioxide. We read about the excess of carbon dioxide in the atmosphere and now it may be influencing our climate. But the
    8·1 answer
  • 7. Once anaerobic respiration takes place, are the effects permanent? Why or why not?
    8·1 answer
  • Why is the solar system important
    9·2 answers
  • An injection well is used to place fluid
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!