1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
2 years ago
13

Condition plant cells require

Biology
1 answer:
Morgarella [4.7K]2 years ago
6 0

Answer:One type  of active transport is called the sodium-potassium pump which helps muscle cells contract.

Explanation:like if you dont have a sodium-potassium  your bone wil have been weaker.

You might be interested in
How to clean out the prostate with enzymes and acids?
slavikrds [6]
Prostatic acid phosphatase was purified from prostatic fluid. Monospecific antisera to the purified acid phosphatase was then produced in rabbits. When antibody was coupled with acid phosphatase, the enzymatic activity was markedly stabilized against pH and temperature degradation. Both acid phosphatase and rabbit anti acid phosphatase were non specifically coupled to Sepharose-4B using cyanogen bromide. Under these circumstances slight stability occurred when antibody was bound to Sepharose, and then acid phosphatase added to the gel antibody complex. When acid phosphatase was complexed to Sepharose, no stabilization occurred.
4 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Does Kudzu help with soil erosion in the environment Explain why or why not
horrorfan [7]

Solution:

The correct answer is:

Yes, Kudzu helps prevent erosion.

Explanation:

Kudzu is a leafy vine that can prevent soil erosion. This is due to its wide leaves and strong root system that prevents soil erosion. In fact, Kudzu exhibits a symbiotic relationship with nitrogen-fixing bacteria, which may help explain their successful growth on heavily eroded sites. The kudzu cover prevents soil erosion because produces a high density of organic matter and this slows down the speed of rainwater. Also, Kudzu maintains soil moisture and prevents runoff even on steep slopes.

3 0
1 year ago
Hey happy winter holiday! take some points fellow goblins also I hope you have a day and don't forget to eat something because y
dimulka [17.4K]

Answer:

Thank you! :) you are awesome and happy holidays to you!

Explanation:

Ya your stomach hurts when something else happens and that REALLY sucks lol!

Although its not really you stomach and more like intestines but still REALY sucks.

5 0
3 years ago
Choose a flower and examine its different parts. Take the flower apart one step at a time. If you need help, review these
Alex_Xolod [135]

Answer:

nahsusjsnzjzkakakka,amsksjksjdjxjzjzjzzj

Explanation:

yahznznzmzmxnzjzmxnxnsnsn iahananamx woaoajsns znan iaiajanananana iaiajakanwnw aiwjjwjwnene iwiwjwjwnama aikwwjjaja kwkw

7 0
3 years ago
Other questions:
  • Stone rings, pingoes, and rock glaciers and other ___________ activity became more common during ice ages.
    10·2 answers
  • How are the density and temperature of air related?
    7·2 answers
  • Which state of matter is best as a thermal insulator? Give an example.
    13·1 answer
  • A star with a surface temperature between 5,000 K and 6,000 K appears _____. blue yellow red white
    13·1 answer
  • Which numbered arrow represents the promoter for RNA II. RNA II serves as the primer for DNA synthesis for plasmid replication.
    14·1 answer
  • Which of the following is a type of Arachaebacteria? halophile thermophile mesophile all of the above
    10·1 answer
  • What are Carotenoids?
    7·2 answers
  • What is rho?explain ​
    12·1 answer
  • I’ll give brainliest!
    7·2 answers
  • In the Galapagos Island finches, the variation in the beak shape correspond to which finch characteristic?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!