1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
13

Difference between the desert and tundra biomes is

Biology
2 answers:
Cerrena [4.2K]3 years ago
8 0
A desert is a hot wasteland covered with sand and a tundra is a frozen wasteland covered in ice
nydimaria [60]3 years ago
4 0

The difference is the temperature.

You might be interested in
What structure inside the cell is most similar to the digestive system in humans ?
shepuryov [24]
Mitochondria is the closest  thing to the digestive system
3 0
3 years ago
Read 2 more answers
Which question is a nonscientific question? Why are roses the best flowers? Does the color of a rose affect how long it blooms?
svlad2 [7]

A non scientific question is a question which cannot be proved to be true as no experiment or no data can be gathered from it. Why are roses the best flowers? is an example of  nonscientific question. The answer of this question is subjective and it brings no scientific data. Scientific question on the other hand is a question that may lead to a hypothesis and help us in answering (or figuring out) the reason for some observation.

3 0
3 years ago
Read 2 more answers
(a)
mash [69]
Because it has to be that way
5 0
3 years ago
Venus is known for its
borishaifa [10]
B. thick atmosphere
You can also use quizlet to look up answers also, I'm in college and they have never failed me.
3 0
3 years ago
Which scenario most likely reveals an organism lacking the proper reactants for cellular respiration? a tree responding to a fun
Lorico [155]
I believe that it's an exhausted bear. Cellular respiration is the way plants and animals receive energy. If the bear is exhausted, it means it's cellular respiration is lacking.
4 0
3 years ago
Other questions:
  • Does salt dissolve in water if it does why
    11·2 answers
  • What are the three common parts of a nucleotide?
    14·1 answer
  • Water in the diet can come from the foods that you eat, as well as liquid foods and beverages. The dietary reference intake for
    5·1 answer
  • Which statement about inheritance is true? Girls get most of their traits from their moms; boys get most of their traits from th
    14·2 answers
  • Why is it important to use mla format??
    9·1 answer
  • What happens to dna as generations of a species continue to reproduce
    10·1 answer
  • Can someone please help
    10·1 answer
  • Can you guys help me please I’ve gotten to many wrong already.
    8·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How does heat flowing through Earth's layers contribute to the formation of an ocean basin?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!