1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir1956 [14]
3 years ago
8

In two or more complete sentences, compare relative dating and absolute dating of earths materials.

Biology
1 answer:
Romashka-Z-Leto [24]3 years ago
6 0

Absolute dating deals with age of rock and relative dating deals with age of fossils.

Explanation:

Absolute age is mainly used to measure the actual age of an object. Relative age is mainly used to determine the age of an object related to other objects.

Absolute age is exact in nature but in the other case relative age is estimated in nature.

To determining age of fossils relative dating is used but in the other hand while determining age of rocks absolute dating is used.

Example in case of absolute age if somebody says she has a younger brother who is 2 years old and elder brother who is 12 years old she is specifically mentioning the age whereas in relative age no age will be specifically mentioned.

You might be interested in
Which of the following animals uses its grinding teeth to chew food
lara31 [8.8K]

Answer:

the answer is the elephant

7 0
3 years ago
BRAINLIESTTT ASAP!!!
FromTheMoon [43]
Temperature affects a star size and the light it emits and it also affects it luminosity. When a star is cold it usually emits a blue color and when its hot it emits a reddish color. For example, up close to the sun it appears red, this is because the temperature is hot.
.
Hope this helps :)
4 0
3 years ago
How do humans raise the odds that their children will survive to reproduce???
Svetlanka [38]
I would say by making sure they raise them as healthy as possible and making sure they get vaccinated 
4 0
3 years ago
1. What is observation?
Sedbober [7]

Answer and Explanation:

Observation is when you take a look at something really closely like examining the object.

For example:

You watch an interesting bird that you've never seen in you're life and  decided to study it's feasters. That's called "Observing'.

7 0
4 years ago
Does sound travel faster in a warm room or a cold room?<br> Edplain your answer.
Dvinal [7]

Answer:

Answer and Explanation: Sound travels faster in a warm room because the molecules are moving faster.

4 0
2 years ago
Other questions:
  • Name the bacteria food in root nodules of leguminous plant​
    7·1 answer
  • An atom of radon gas emits an alpha particle as shown below. Radon-222 has 86 protons and 136 neutrons. What daughter product wi
    14·1 answer
  • Elephants shape their environment in many ways. They can change a forest to a grassy field or dig a hole that might become a pon
    15·2 answers
  • The pen on a seismograph swings freely. True or false
    15·2 answers
  • This example of sedimentary rock is formed when rock fragments, minerals, and the remains of plants and animals are deposited as
    11·2 answers
  • Explain why cancer is more common in older adults
    10·1 answer
  • In a case-control study of computer display exposure and glaucoma, cases and controls were also asked about television watching
    10·1 answer
  • Down syndrome is a genetic disorder that is also called trisomy 21. A person with Down Syndrome has an extra copy of chromosome
    11·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What do these questions mean ? WILL GIVE BRAINLIEST :) pls give an example etc
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!