1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
13

If a problem with RNA interference is caused by a failure of the target mRNA to be cleaved and degraded, but all other steps in

the process proceed as normal, this is likely the result of a problem in which of the following components?
(A) Guide strand
(B) Argonaute
(C) shRNA
(D) Dicer
Biology
2 answers:
ioda3 years ago
4 0

Answer:

(B) Argonaute

Explanation:

Dicer is a helicase enzyme with a proper RNA motif and encodes ownself by utilizing DICER1 gene. In dsDNA, RISC is activated by the help of dicer enzyme and it also regulated the process. RISC has a catalytic component Argonaute, which is an endonuclease capable of degrading messenger RNA (mRNA). When this endonuclease malfunctions, the mRNA no longer be degraded and this failure leads to improper protein translation.

cricket20 [7]3 years ago
3 0

Answer: D- Dicer

Explanation:

Dicer, also known as endoribonuclease Dicer or helicase with RNase motif, is an enzyme that in humans is encoded by the DICER1 gene. Being part of the RNase III family, Dicer cleaves double-stranded RNA (dsRNA) and pre-microRNA (pre-miRNA) into short double-stranded RNA fragments called small interfering RNA and microRNA, respectively. These fragments are approximately 20-25 base pairs long with a two-base overhang on the 5' ends. Dicer facilitates the activation of the RNA-induced silencing complex (RISC), which is essential for RNA interference. RISC has a catalytic component Argonaute, which is an endonuclease capable of degrading messenger RNA (mRNA).

You might be interested in
What 3 phyla constitute most of the Animal Kingdom? (specify if invertebrate<br> or vertebrate)
mihalych1998 [28]

Answer:

arthropoda : invertebrate

mollusca : invertebrate

chordata : vertebrate

Explanation:

There are 9 in total but those are the main 3

7 0
1 year ago
How does the sheep brain compare to the human brain? Identify at least two differences.
asambeis [7]

Answer:

Sheep Brain:

Sheep brain is smaller in size the human brain. The convolutions or folds are absent in sheep brain. Olfacory bulb is more developed in shhep's brain as compared to human brain. Sheep brain is more elongated in shape.

Human brain:

Human brain is large in size. The convolutions are more numerous in human brain. Human's brain olfactory bulb is less developed as compared with sheep's brain. Human brain is round in shape.

4 0
3 years ago
Why are the prefixes “mono” “di”, and “poly and the base “saccharide” good to use when describing the three types of carbohydrat
jolli1 [7]

Answer:

“Mono” denotes one, “di” denotes two, and “poly” denotes a large number. 

What is the significance of these words in defining the 

three forms of sugars? 

These terms are used because they depict how the 

molecule appears. 

The molecule's base unit is called a "saccharide."

Explanation:

-

7 0
2 years ago
Which is true about the tides? A. High tide is when the ocean water level is the lowest. B. Between high tides, there is a low t
Hoochie [10]

Answer:

I believe the answer is B.

Explanation:

It's not A, C and I don't think it's D.

As the Earth rotates, your region of Earth passes through both of these bulges each day. <u>When you're in one of the bulges, you experience a high tide. When you're not in one of the bulges, you experience a low tide.</u> This cycle of two high tides and two low tides occurs most days on most of the coastlines of the world.

7 0
3 years ago
Read 2 more answers
A cytoskeleton is:_______.
Softa [21]

Answer: e

Explanation: Cytoskeleton is a microfilaments, intermediate filaments, and microtubules that provide support and movement for eukaryotic cytoplasm.

1. Prokaryotic cytoplasm lacks certain features of eukaryotic cytoplasm, such as cytoskeleton and cytoplasmic streaming.

2. The cytoskeleton provides support and shape to cell.

3. It help in transporting substances through cell.

4. It help in phagocytosis.

5. It help in cytoplasmic streaming that is movement of eukaryotic cytoplasm from one part of cell to another which help distribute nutrients and move the cell over the surface.

6. The study of the numerous interaction between microbes and host cell cytoskeleton is a very intense area of investigation on virulence mechanism.

7 0
2 years ago
Other questions:
  • Which of the statements below about sexual selection is NOT correct?
    12·1 answer
  • Water, wind, and solar energy can be replenished over relativity short time span, so they are called
    7·1 answer
  • A molecule of mRNA with the sequence GGUCAUCACUAU experienced a
    5·1 answer
  • Some molecules found in foods are known to be capable of driving DNA methylation or DNA demethylation. For example, folic acid (
    5·1 answer
  • Search around your house. Name two examples of<br> objects that show mechanical energy.
    9·1 answer
  • What is the key element found in C02 and glucose
    10·2 answers
  • (06.03 LC) Which of the following is an example of how HIV can be transmitted from one person to another? Contact between infect
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How are the same procesess of mitiosis and meosis simullar to each other?
    5·1 answer
  • Explain where scientists think Earth's water may have come from.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!