Answer:
If you add food coloring to milk how would it be affected?
Then you add 3 drops in the milk
Because it will affect the color of the milk
Answer: yes
Explanation:
because learning how the hierarchy works let’s the student understand how an ecosystem is effected if one thing was taken or destroyed. This is an important factor because this is where adaptation begins after something happens and the animals all have to learn to adapt.
Answer:
Dehydration.
Explanation:
Dehydration is the cause of this weakness, in relation to cellular respiration because in cellular respiration water is produces when the glucose molecules are broken down for the release of energy. In this process, our body temperature increases so our body removes heat from the body with the use of water which leads to dehydration and the athlete feels hard and becomes dizzy and feels ill and weak.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
I think it is hydrolysis, because hydro means water and olysis means to break apart.
