1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
4 years ago
6

What binds to the prokaryotic chromosome to start dna replication?

Biology
1 answer:
Scorpion4ik [409]4 years ago
6 0

Answer:

DNA Helicase

Explanation:

The process of DNA replication is very complex and requires a variety of proteins in the form of Enzymes.

The DNA replication starts at the site which is about 245 base pairs long and is rich in AT sequences called Origin of replication. The origin of replication recognised by an enzyme called DNA helicase which breaks the hydrogen bonds present between the bases and unwinds the DNA. The RNA primase enzymes then synthesizes an RNA primer which gets attached and to which DNA polymerase binds and add nucleotides.

Thus, the first enzyme that binds to the DNA is DNA helicase.

You might be interested in
How can two alleles from different genes be inherited together
valina [46]

alleles of different genes tend to be connected together when does genes are on the same chromosome the Offspring received one recessive allele from each parents

Hope it helps

4 0
3 years ago
what is the name of the process of liquid water changing into water vapor due to heating? A. respiration B. evaporation C. photo
Andreas93 [3]
B.) Evaporation
it says i have to ad more charcecters sooooo here ya gooooooo
3 0
4 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
explain the relationship between the brain and conscious experience of the world with reference to the thalamus and reticular fo
VLD [36.1K]

Consciousness is defined as the state of awareness of self and the environment. Another way of describing it is a condition for which a person is capable of perceiving stimuli from the environment and responding appropriately.

The consciousness system has two principal functions:

1) Maintenance of waking state (arousal or level of consciousness)

2) Content of experience (awareness or content of consciousness)

It is important to understand the difference between these two. Arousal shows the wakefulness of one person and awareness is the person ability to perceive the environment. In vegetative state, ones are awake but unaware of themselves or the environment.

In this article, we will look into the concept of neuronal system involved in consciousness system. It is crucial to realize that detail discussion is beyond the scope of this article and only essential and relevant elements to the

3 0
4 years ago
Which of the following is not true of RNA processing?
horsena [70]

Answer:

A

Explanation:

Exons are what are needed in the processing mRNA hence cannot be cut out. The regions that are cut out are introns and mainly emanate from non-protein-coding region of DNA. During RNA processing the mRNA is capped at the 5’  end and three (3) adenine nucleotides are added on 3’ end of the RNA- in a process called polyadenylation –to stabilize the mRNA. This processing is carried out by enzymes such as ribozymes and spliceosomes. RNA requires to be processed before it exits the nucleus.

5 0
3 years ago
Other questions:
  • What kind of tests can be used to distinguish archaea from bacteria?
    13·1 answer
  • In all animals, the largest percentage of the body's fluids are located in the:
    5·1 answer
  • Describe the characteristic that defines members of the kingdom Plantae. Describe four characteristics that distinguish land pla
    11·1 answer
  • How do humans use plant's ability to reproduce asexually
    12·1 answer
  • Animals and plants have cells that are specialized by the process of _____.
    9·1 answer
  • How does the offspring’s genetic code from asexual reproduction compare to the parents genetic code?
    13·1 answer
  • How do triglycerides play an important role in human metabolism?
    15·1 answer
  • Not all organisms in a population are equipped the same for____?​
    5·2 answers
  • Plants are an important part of an ecosystem
    6·2 answers
  • Rock pocket mice are rodents found in the desert Southwest. They are typically light/tan, but a mutation in the population codes
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!