1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nydimaria [60]
3 years ago
9

The American Academy of Pediatrics recommends that all infants and children, starting shortly after birth, have a minimum daily

intake of 400 IU of vitamin D. Infants are likely to require supplemental vitamin D because
Biology
1 answer:
garik1379 [7]3 years ago
5 0
<span>The American Academy of Pediatrics recommends that all </span>babies<span> receive </span>vitamin D<span> supplementation (400 IU per day) due to decreased sunlight exposure and an increase in rickets.

Babies need this due to lack of sunlight exposure and is highly recommended if they're breastfed.</span>
You might be interested in
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
On and around earth, all of the following reflect incoming sunlight, EXCEPT?
masha68 [24]
I think it's D) atmospheric carbon dioxide.
7 0
3 years ago
Read 2 more answers
2. David is growing algae in a closed bottle for an experiment. The bottle is half full of water and half full of air. David flo
Viktor [21]
For this one it would be B because
3 0
3 years ago
Read 2 more answers
Explain one advantage to scientific naming over common names.
MAXImum [283]

scientific names known over all word or as internationaly

5 0
3 years ago
How does human population increase affect aquatic resources ​
torisob [31]

Answer:

as the human population grows, more people will on be on earth and if those people pollute in the ocean the ocean will get dirtier and unhealthy for the underwater creatures.

5 0
3 years ago
Other questions:
  • The first animals to live successfully on land were
    11·1 answer
  • Describe what occurs to a molecule of the enzyme trypsin AFTER it binds to a molecule of protein?
    5·1 answer
  • In _[blank]_ the cuplike opening of the gastrula develops into the organism's mouth.
    6·2 answers
  • I'm taking online classes I need to know, <br> what is chemistry?
    11·2 answers
  • Explain how human activity can impact the limiting factors of river ecosystems.
    9·2 answers
  • What impact does altitude have on pressure?
    7·1 answer
  • Which of following correctly matches the protein isolation step with its result. Group of answer choices homogenization: breaks
    8·1 answer
  • On average, the adult brain loses _____ percent of its weight between the ages of 20 and 90.
    6·1 answer
  • Plss help me with this carbon cycle!!!!
    9·1 answer
  • Why is there two variations of each characteristic? <br><br> Please explain :) !!
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!