1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EleoNora [17]
3 years ago
15

Helper t cells and regulatory t cells ________.

Biology
1 answer:
hjlf3 years ago
4 0
It has to be a , T cells are are your killer cells
You might be interested in
Describe one advantage prokaryotes cells have over eukaryotic cells
Helga [31]
Answer: Prokaryotes are primitive and are in a simpler form

Explanation:
Since Prokaryotes are primitive and have a simpler form, they have an advantage in quick reproduction and the ability to adapt to any new environment .

Hope it helps!


6 0
3 years ago
Photosynthesis is the process that uses light energy to extract hydrogen atoms from __________.a. Lightb. Waterc. Oxygend. NADPH
Illusion [34]

Answer:

b Water the light energy (sunlight) extract the hydrogen atom from the Water

3 0
4 years ago
Read 2 more answers
What is the formula for lipids
Sati [7]
Fats and Oils. The triesters of fatty acids withglycerol<span> (1,2,3-trihydroxypropane) compose the class of lipids known as fats and oils. These triglycerides (or triacylglycerols) are found in both plants and animals, and compose one of the major food groups of our diet.</span>
7 0
4 years ago
___________ separate(s) a carrying species from a nesting species. Response to loving and kissing Interest in cuddling and playi
Sedbober [7]

Breast milk composition and frequency of demand feedings separate a carrying species from a nesting species.

<h3>What does patterns of parental care mean?</h3>

The patterns of parental care can be defined as stimuli that shape the relationship between parent and offspring in different species.

Carrying species are those species where parent care do not involve building nests for their offspring (conversely to nesting species).

In conclusion, breast and demand feedings separate a carrying species from a nesting species.

Learn more about nesting species here:

brainly.com/question/12023002

#SPJ1

7 0
2 years ago
(20 point) {brainliest} please help meeee
Ne4ueva [31]
C. The palms are on the anterior surface of the hand.
6 0
3 years ago
Read 2 more answers
Other questions:
  • A student is studying the amino acid sequence of a protein shared by four organisms. The student wants to know which organism is
    11·1 answer
  • How does algae reproduce? Select the best answer.
    12·1 answer
  • Can someone please help me finish this T-T
    7·2 answers
  • The law of segregation states that one gene from each pair goes to
    14·1 answer
  • Which of the following is NOT a phenotypic test?
    12·1 answer
  • "If a neurotransmitter that binds with a metabotropic receptor causes an escalating sequence of events, then a(n) _____ has occu
    7·1 answer
  • Where are the keratinocytes located?
    10·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Which of the following examples is NOT a way that matter is conserved in the
    11·1 answer
  • All of the following are examples of courtship rituals except:
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!