1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lina20 [59]
3 years ago
7

Which planetary body has the greatest gravity pull

Biology
2 answers:
sergij07 [2.7K]3 years ago
8 0
Jupiter because massive gravitation
Evgesh-ka [11]3 years ago
4 0
Jupiter, because its the biggest.
You might be interested in
I dont know where to put this under
Over [174]
I think it’s evaporation proton
4 0
3 years ago
Read 2 more answers
In 1986, hundreds of islands were created out of hilltops when venezuela was flooded because of a closed dam. on all of these ne
FromTheMoon [43]
Any herbivores would have thrived if left alive. same with the smaller predators like foxes or owls. populations shoot up. increase in inbreeding if the islands are isolated and eventually disease catches up with them
6 0
3 years ago
Read 2 more answers
In both sexual and asexual reproduction, offspring have the same number of genes as the parent organisms. What else is true abou
Lunna [17]
A. offspring are genetically identical to their parents
7 0
3 years ago
Read 2 more answers
Explain how a ship made of materials that are much denser than water is able to float on water?
velikii [3]
Because the weight is evenly distributed
5 0
3 years ago
Denzel's mom has asked him to organize the family's trash for disposal. Which of these items should he put with the hazardous wa
hjlf
The answer would be used batteries. You would be able to recycle the vegetable waste within fertilizing and/or throw it away safely by disposing it in a trashcan since it is not a hazard towards the environment. As for aluminum cans, they are recyclable and are easy to use again once it is filtered through the system. However, batteries are NOT recyclable nor easy to dispose because they can release Alkaline which can harm the environment.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Give an overview of the process depicted in the diagram
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Ron is running an experiment to see if certain sounds can improve memory. While testing the subjects’ memory, Ron unintentionall
    5·1 answer
  • How does doppler effect related to expanding universe
    7·2 answers
  • A thin-shelled crab can more readily move to escape a predator than can a thick-shelled crab, but it is more vulnerable to preda
    5·1 answer
  • facilitated diffusion requires _____. a. membrane proteins b. transport proteins c. membrane pouch d. energy
    5·2 answers
  • According to the phenotypic characters of pneumococcus considered in Griffith's
    10·1 answer
  • How does the respiratory system interact with the circulatory system?
    11·1 answer
  • Pleas help... pleas help pleas help!!!!!
    12·1 answer
  • Which terrestrial planet is cold, has a small atmosphere, and is known for having violent storms for weeks?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!