1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
8

If the cell were a factory, this part of the cell would be the packaging for export center,

Biology
2 answers:
Wewaii [24]3 years ago
7 0
The Golgi Complex

The Golgi Complex basically functions as a "packaging center" for the cell, attaching "address labels" (functional groups) to various cell
musickatia [10]3 years ago
6 0

Answer:

yes

Explanation:

because fectory so duty

You might be interested in
This is a 3 letter sequence of DNA or messenger RNA code that stands for one amino acid in a protein.
kogti [31]
The 3 letter sequence of DNA or messenger RNA code that stands for one amino acid in a protein is called Codon
8 0
3 years ago
What description best explains why viruses can become more pathogenic to host that were not affected by the virus before?
ANEK [815]

Answer:

New cells are naive to the infectious cells who attack it or they are not well prepared to deal with the different scenarios. But, the cells who are attacked before has the set or sequence of the viral or bacterial genome strand been identified by them, which leads to more safety or protection from these foreign bodies.

Explanation:

  • Mechanism To attack a host cell:

The viruses and other infectious material enters and attacks the host cell, by breaching its membrane wall and installing or leaving a gene of its own inside the cell. Which then combines with the genome of the cell and it goes through the process of replication, translation etc,along with the host cell machinery. Which then spreads the specific gene strand more in the environment

  • <u>Camouflage obtained by the infectious cell to hide it self:</u>

After the genome enters the host cell at first it does not recognizes the strands or foreign cells, as they cover there body with a camouflage sort of membrane and they look more like the body cells.

  • <u>Reactions by the host cell and as a whole the body:</u>

The organisms detects the genome of the infections cells or strand, as they store the data about it in its server or database. As if the next time they were under attack then precautions will be there by the host cell to deal with it.

As for the cell who are never attacked before will be less safe to deal with these foreign bodies.

5 0
3 years ago
The lithosphere is a rigid layer made of Earth's entire crust and the very top part of Earth's mantle. This rigid layer is divid
Korolek [52]
Molten rock moving around the planet
5 0
2 years ago
Read 2 more answers
The wild-type form of a gene encodes a protein of length 100 amino acids. A mutant allele has a UAA (instead of the wild-type, C
Orlov [11]

Answer:

48 amino acids

Explanation:

The wild type gene codes for a protein with 100 amino acids. One amino acid is encoded by one triplet code of the gene. This means that the wild type gene has a total 100 triplets or 300 nucleotides to code for a protein of 100 amino acid. Mutation in this protein has introduced the code "UAA" at the 49th codon. The code "UAA" is a stop codon. Therefore, the mRNA transcribed from the mutant allele would code for a protein having 48 amino acids as the protein synthesis will be stopped once the stop codon at the 49th position is read.

8 0
3 years ago
Which of the following explosive materials is available in commercial form as fertilizer?
Sveta_85 [38]
<span>ammonium nitrate is found in fertilizers</span>
3 0
2 years ago
Other questions:
  • Please help!!! Brainliest will be given!!!
    12·1 answer
  • Which of the following phyla contains only marine animals?
    11·2 answers
  • Which of the following steps of excitation-contraction coupling are different between skeletal muscle and contractile myocardium
    15·1 answer
  • In northeast kansas there is a creature know as a wildcat. it comes in three colors, blue, red, and purple. this trait is contro
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which of these would BEST describe the structural difference between magnesium and aluminum?
    9·2 answers
  • Which phase of meiosis 2 forms four haploid cells?
    5·1 answer
  • For each molecule of glucose that is processed by glycolysis and the citric acid cycle, what is the total number of nadh fadh2 m
    9·1 answer
  • This is a molecule of glucose, a simple carbohydrate. If this molecule were broken down, would it provide all of the elements ne
    12·1 answer
  • How does tetanic contraction of muscles help to lift objects heavier than our body weight?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!