1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vesna_86 [32]
3 years ago
13

If a smoker has a low tidal volume why might he feel tired and run down

Biology
2 answers:
IceJOKER [234]3 years ago
6 0
The flow of oxygen in the smokers body is low as his lungs do not have enough magnitude.
OLEGan [10]3 years ago
4 0

oxygen flow is low and his lungs do not have a lot of capacity

You might be interested in
Is oxygen necessary for the production of apt in your cells?
gizmo_the_mogwai [7]
Yes it is necessary for the production of apt in your cells because apt needs oxygen to form correctly.
7 0
3 years ago
Which ecosystem would be affected the most by losing its butterflies, and why?
pickupchik [31]

Answer:

a

Explanation:

7 0
3 years ago
Read 2 more answers
Explain the importance of the blood returning to the heart twice in one cycle​
a_sh-v [17]

Answer:

Explanation:

It is called a double circulatory system because blood passes through the heart twice per circuit. The right pump sends deoxygenated blood to the lungs where it becomes oxygenated and returns back to the heart. The left pump sends the newly oxygenated blood around the body.

6 0
3 years ago
How does comparative anatomy support the idea that organisms share ancestors?
REY [17]
When you compare different organisms and see that they have the same or similar anatomic traits, it's reasonable to assume the organisms share a common ancestor where they would have gotten trait from. (evolution)
6 0
3 years ago
In the nervous system, neurotransmitters are the main means of communication between neurons. The main means of communication be
Serhud [2]

Answer:

The answer is hormones.

Explanation:

Two of the main systems that control almost every action in our body are our nervous system and endocrine system which have to have inner communications and communication with our brain.

As stated in the question, nervous system uses neurotransmitters for communication which are chemicals released by neurons to generate electrical signals that make the communication possible.

The main mean of communication that our endocrine system uses is substances that are called "Hormones" which are produced by certain glands and organs in our body and are usually released into our bloodstream to effect the functions of other organs and our body. Hormones can be used for both communication of the endocrine system itself and for the communication of other organs and our brain.

I hope this answer helps.

6 0
3 years ago
Other questions:
  • Misting increase water loss from plant leaves while roots are forming.<br><br> TRUE<br><br> FALSE
    15·1 answer
  • During interphase where are chromosomes located within the cell
    12·1 answer
  • In which step of translation does the RNA become charged?<br> activation<br> elongation
    12·1 answer
  • An observation which requires measurement is called:
    11·1 answer
  • First person to Answer gets a Brainliest!!
    10·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • 1. What is the relationship among chromosomes, genes, and DNA?
    5·2 answers
  • Environmental designers design structures to match the environment.
    9·1 answer
  • 6. In the gene pair Tt, the symbol T represent
    11·1 answer
  • Royal jelly is fed continuously to the queen bee for six days. Why? <br>​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!