Which procedure uses a CT scan to pinpoint the location of a mass in three dimensions and guide the biopsy needle?

Biology

2 answers:

GrogVix [38]2 years ago

5 0

Answer:

The answer to the question: Which procedure uses a CT scan to pinpoint the location of a mass in three dimensions and guide the biopsy needle, would be, B: Stereotactic biopsy.

Explanation:

This procedure is mostly used in cancer diagnosis and cancer treatment and its purpose is to accurately locate tumor, particularly those that are atypical, and allow a doctor to extract necessary tissue from the tumor itself through biopsy. Because of the need to ascertain the exact location, size and structure of the tumor, CT scans are used to view in two planes the position in a three-dimensional space and exact biopsy is also favored by this procedure.

Eva8 [605]2 years ago

3 0

The best and most correct answer among the choices provided by the question is stereotactic biopsy .

Stereotactic biopsy, also known as stereotactic core biopsy, is a biopsyprocedure that uses a computer and imaging performed in at least two planes to localize a target lesion

Hope my answer would be a great help for you. 
If you have more questions feel free to ask here at Brainly.

You might be interested in

Which of the following does not contribute to the formation of the mid atlantic ridge

dedylja [7]

Answer:

This submarine Mid-Atlantic Ridge owes its formation to the movement of the continental plates on either side of the ocean. As these plates slowly separate, they leave gaps in the earth's crust. This allows molten rock from beneath the earth's crust to reach the surface, forming a new part of the ocean floor

5 0

2 years ago

Made up of iron and nickel

Vinvika [58]

Answer:

Alloy is a mixture made up of iron &nickel.

5 0

2 years ago

This diagram shows to glucose monomers being linked up for maltose sugar. The process that link the two together is

vampirchik [111]

We just learned this ! it's hydrolysis

4 0

2 years ago

Kepler discovered that

Setler79 [48]

Answer:

all of the above

Explanation:

gravity makes a planet have a combination go straight yet go around the sun at the same time creating an ellipse

sciencefocus

5 0

2 years ago

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago