Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Phenotypically and genotypically there are only two different ratios. If you think of a Punett square...
<span>You could say that a pea plant with the trait for the dominant color green (G) could also carry the recessive trait for yellow (g). So let's say you mate a dominant green, (Gg) with another dominant green, (Gg). You would get 1 (GG), 2 (Gg) and 2 (gg). </span>
<span>Phenotypically (as in physical traitwise), the ratio is 3:1 because you have 3 green colored peas and one yellow. </span>
<span>Genotypically (as in traitwise), the ratio is 1:2:1, because you have 1 (GG), 2 (Gg) and 1 (gg). </span>
<span>So although it's random, for any specific trait there are only 4 different outcomes.</span>
The right option is; dark-field microscope
A light microscope that makes the specimen appear light on a dark background is called a dark field microscope.
Dark field microscopes are light microscopes that are used in different ways to clearly view various specimens that are unstained, transparent, and hard to see using a light field unit. Dark field microscopes are very effective because they show the details of unstained and live samples. It is also very simple to use, and inexpensive to set up.
The release of absorption is CHEMICAL CHANGE. A chemical change is a type of change in which a new product is produced. Heat is either released or absorbed during a chemical change, and this heat change indicates the bonds have been broken and rearrange. Do the answer is C. CHEMICAL CHANGE.
MARK ME BRAINIEST
