1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
4 years ago
10

Which part of cellular respiration uses 2 ATP and produces 4 ATP per glucose molecule?

Biology
1 answer:
frutty [35]4 years ago
6 0
This is what I think that the answer is. Glycolysis consist of 10 rxn.....among them rxn 1 and 3 uses single ATP each <span>
and .... rxn 6 and 9 produces 2 ATP each by substrate level phosphorylation</span> 
I hope that this helped you in anyway


You might be interested in
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
HELP!!!!! ASAP!!! 10 points
Ad libitum [116K]

Answer:

42???

Explanation:

5 0
3 years ago
How can the random distribution of alleles result in a predictable ratio?
levacccp [35]
Phenotypically and genotypically there are only two different ratios. If you think of a Punett square... 

<span>You could say that a pea plant with the trait for the dominant color green (G) could also carry the recessive trait for yellow (g). So let's say you mate a dominant green, (Gg) with another dominant green, (Gg). You would get 1 (GG), 2 (Gg) and 2 (gg). </span>

<span>Phenotypically (as in physical traitwise), the ratio is 3:1 because you have 3 green colored peas and one yellow. </span>

<span>Genotypically (as in traitwise), the ratio is 1:2:1, because you have 1 (GG), 2 (Gg) and 1 (gg). </span>

<span>So although it's random, for any specific trait there are only 4 different outcomes.</span>
4 0
3 years ago
A light microscope that makes the specimen appear light on a dark background is called a(n) _____. compound microscope electron
AnnZ [28]

The right option is; dark-field microscope

A light microscope that makes the specimen appear light on a dark background is called a dark field microscope.

Dark field microscopes are light microscopes that are used in different ways to clearly view various specimens that are unstained, transparent, and hard to see using a light field unit. Dark field microscopes are very effective because they show the details of unstained and live samples. It is also very simple to use, and inexpensive to set up.


7 0
3 years ago
Read 2 more answers
What does the release or absorption of energy indicate?
Rainbow [258]

The release of absorption is CHEMICAL CHANGE. A chemical change is a type of change in which a new product is produced. Heat is either released or absorbed during a chemical change, and this heat change indicates the bonds have been broken and rearrange. Do the answer is C. CHEMICAL CHANGE.

MARK ME BRAINIEST

4 0
3 years ago
Read 2 more answers
Other questions:
  • What type of molecule serves as the inorganic carbon reservoir for photosynthesis?
    9·2 answers
  • what is another analogy for describing the difference between prokaryotic cells and eukaryotic cell??
    6·2 answers
  • Which best describes the relationship between population size, carrying capacity, and limiting factors?
    10·2 answers
  • Try to list three common, non-animal food items that are not angiosperms.
    7·2 answers
  • What is the relationship between increased carbon in the ocean and increased carbon in the soil?
    9·1 answer
  • A scientist is studying specialized cells that help pump blood. Which cells is she most likely studying?
    7·1 answer
  • A certain type of flower has two alleles for color (blue, purple), and two alleles for stem height (tall, short). A tall blue fl
    6·1 answer
  • The agricultural revolution took place approximately A. 300 years ago B. 100,000 years ago C. 100 years ago D. 10,000 years ago
    11·1 answer
  • HELP ASAP Which of the following are NOT decomposition reactions. Check all that apply. A. 2SO3(g)⇒2SO2(g)+O2(g). B. K2CO3(s)⇒+C
    13·1 answer
  • Adrian Raine studied the brains of violent repeat offenders and found that their brains had _____ frontal lobe tissue than the b
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!