No all rock dont have to go through a complete life cycle......i mean some could it but it dont have to be in any exact order ..... so your answer would be false
Answer:
(b) - False
Explanation:
Prochlorophyte bacteria are photosynthesizers and have the same chlorophyll found in algae and vegetables, studies claim that these bacteria are the most abundant beings on the planet, accounting for half of all photosynthesis performed in the oceans.
Prochlorophyte bacteria can be divided into <em>Prochloron</em>, <em>Prochlotrix</em> and <em>Prochlorococcus</em> genera.
However, <u>prochlorobacteria</u> are not responsible for the production of dairy products, in which the most associated bacterial genera are <em>Lactobacillus</em> and <em>Streptococcus</em>. This last statement implies that alternative b is the correct one.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
A fixed set of steps and procedures
