1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
4 years ago
5

Which of the following is not a function of the large intestine?

Biology
1 answer:
vitfil [10]4 years ago
7 0
Strokes seizure possibly heart failure or even the bisector of the photosynthetic parliament ousted this lies humanitarian and leishmaniasis
You might be interested in
Compare and contrast safe practices used during field investigations with those used in laboratory situations.
mihalych1998 [28]

Answer:

in the field you know how to swim and dive, have appropriate diving equipment, and appropriate diving certifications. as in the lab I wore my apron, latex gloves, and safety glasses. I'm if this is wrong I used google

4 0
4 years ago
If rainfall on sand dunes increases, then the erosion rate of the sand dunes will increase Why is this statement a hypothesis ra
Montano1993 [528]
<span>The statement is a hypothesis rather than a theory because it depends on the volume of the rainfall on sand dunes increases, therefore, there will be a result or conclusion that the erosion of the sand dunes will also increase.</span>
4 0
3 years ago
under certain circumstances, the actin and myosin myofilaments can be extracted from muscle cells and placed in a beaker. they s
nataly862011 [7]

Another ATP-binding site on myosin is where enzymatic activity converts ATP to ADP, releasing energy and an inorganic phosphate molecule. When ATP binding causes myosin to release actin.

<h3>What is the function myosin?</h3>

The first molecular motor, myosin, is a protein that transforms chemical energy in the form of ATP into mechanical energy to produce force and movement.

<h3>What components make up myosin?</h3>

A head, neck, and tail domain make up the majority of myosin molecules. With the exception of myosin VI, which moves toward the pointed (-) end of the filament, the head domain attaches the filamentous actin and produces force by ATP hydrolysis as it "walks" along the filament towards the barbed (+) end.

To know more about Myosin visit:

brainly.com/question/15071887

#SPJ4

4 0
2 years ago
The dominance pattern of a gene can be determined from the phenotypes of the parents and offspring. In the examples below, assum
Usimov [2.4K]

Answer:

A-complete dominant

B-codominance

C-Incomplete dominant

D-codominance

E-Incomplete dominance

Explanation:

Complete dominance- This is when a dominant Allen completely mask the effect of a recessive allele and the offspring express its phenotype E.g . A pea plant with all purple flowers and a pea plant with all white flowers produce a pea plant with all purple flowers.

Incomplete dominance- This occur when the dominant allele doesn't fully dominate over the recessive allele and the offspring shows a combination of both allele(a phenotype different from the parent)

E.g A red snapdragon and a white snapdragon produce a pink snapdragon.

Codominance- This occur when both allele express itself. The phenotype of the offspring consists of both allele example AB blood group

8 0
3 years ago
John’s parents keep their medications in the cabinet in their bathroom, and he and his sister know there is some pain medication
lapo4ka [179]
I’m gonna be honest not sure sorry
7 0
3 years ago
Other questions:
  • Why is it helpful for a microscope to be parfocal??
    7·1 answer
  • Match the following definitions to their correct terms. 1. any chemical compound that contains carbon 2. a liquid that acts to d
    10·2 answers
  • How does apoptosis affect cancer
    6·2 answers
  • How does heredity affect a species
    5·1 answer
  • How does a giraffe meet the basic challenges of life?
    15·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which is considered a chemical mutagen? tanning beds tobacco X-rays precious metals Mark this and return Save and Exit
    11·2 answers
  • What is a group of similar cells that perform a specific function is a(n)
    12·2 answers
  • - - - - 1 1. Humans are: because our cells contain noclei. - 1 1 1 - 1 -​
    12·1 answer
  • What is the Theory of Evolution?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!