Hope this helps you.
The genes of an organism can be
either a homozygous or a heterozygous one. When someone is a homozygous
dominant, it means that it has two copies of the same dominant allele. Homozygous
means that the organism has exact copies of the same gene allele.
Astronomy can best be described as a "<span>a. study of objects beyond earths atmosphere", although the subject of astronomy can be much more complicated. </span>
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Nucleotide is a combination of a sugar, nitrogen base and phosphate groupment
Answer:
Proteins.
Explanation:
If the mRNA is damaged, it directly interferes with the ability of producing proteins in animal cell because mRNA is responsible for carrying the protein blueprint from a cell's DNA to its ribosomes which are considered as the machines of the cell that produces proteins for the cell. These messenger RNA has the information about what type of proteins are required to produced for the cell. So if mRNA is damaged, the ribosomes are unable to produce proteins for the cell.
