1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
3 years ago
5

What is an example of cell wall and also a non example

Biology
1 answer:
dusya [7]3 years ago
6 0
Example - the relatively rigid covering of a plant cell, containing cellulose, hemicellulose, lignin, etc.<span>
non example - </span><span>Mycoplasma because it has no cell wall</span>
You might be interested in
Plz answer I need help​
Bogdan [553]
1.Fish gills are organs that allow fish to breathe underwater. Most fish exchange gases like oxygen and carbon dioxide using gills either on side of the pharynx.

2.Gills are branching organs located on the side of fish heads that have many, many small blood vessels called capillaries.

3.The colour is red

4. A Gill filaments project from each arc between the dorsal upper and ventral lower surfaces of the filaments.
3 0
2 years ago
Which energy sources are limited because they can only be found or gathered in certain locations
Natasha_Volkova [10]
Things such as coal and oil are limited because they are only found in some places
7 0
2 years ago
Which piece of data helps explain the uneven distribution of minerals across earth's crust
mr_godi [17]

Answer:

my best answer is b due to logic if not then d

Explanation:

8 0
2 years ago
Read 2 more answers
Will mark brainliest ⚠️⚠️ please help
Eddi Din [679]

Answer:# 1 is salt #2 is fresh #3 fresh #4 salty

Explanation:

8 0
3 years ago
Which of these forces help protons and neutrons to stay at the center of the atom?
Firlakuza [10]
Can't be gravitational, due to the fact that atoms are way too small to have a gravitational pull for something of similar size.
 

The strong nuclear force is the answer you're looking for.

3 0
2 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which trait distinguishes between the kingdoms of Bacteria and Archaea?
    12·2 answers
  • Explain how a starfish's body plan and anatomy's function very essential to its survival.
    6·1 answer
  • Which compound is produced during regeneration?
    13·2 answers
  • In which kingdoms are all organisms multicellular?
    14·2 answers
  • 2. What types of animals can be produced in a CAFO?
    9·2 answers
  • .In women, aging becomes a significant risk factor for heart disease after the age of:
    9·1 answer
  • Help ASAP!!!!!!! 10 points
    13·1 answer
  • Okay I don't know if this is gonna make sense. But how would you keep animal genes healthy?
    15·1 answer
  • Every year, 25 km 3 of sand is deposited on a beach by a nearby river, and 28 km 3 of sand is removed by wave action. Is the siz
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!