1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
____ [38]
3 years ago
9

An elements atomic number is 62. how many protons would an atom of this element have

Biology
2 answers:
blondinia [14]3 years ago
8 0
The atomic number is equal to 62
coldgirl [10]3 years ago
3 0
The atomic number is<span> </span>equal<span> to the number of protons. The atom has 62 protons.</span>
You might be interested in
If anyone is good at Biology please help me with these 3 questions I am taking online school.
KatRina [158]
Q1-  D
q2- C
q3- B 
I am assuming you only need one answer for each, good luck! 
4 0
3 years ago
Read 2 more answers
4. Read the following sentence from the section "Are All Enzymes Proteins?"
ololo11 [35]

Answer:

D

Explanation:

Pretty sure that's the correct answer.

6 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What are some similarities and between Gigantopithecus and humans?
Basile [38]

Answer:

Gigantopithecus could stand on its hind legs, and the known jaws of Gigantopithecus widen towards the rear and proposed that this widening occurred to allow for the housing of a trachea‭ (‬the‭ ‘‬windpipe‭’ ‬that connects the lungs to the mouth opening‭) ‬when the skull was placed directly in top of the head like a human and not carried forward like a great ape.‭

6 0
2 years ago
When someone is angry, their respiration, heart rate, and sweating increase. The same responses are also seen when someone is af
slamgirl [31]

Answer:

The James-Lange theory of emotion.

Explanation:

According to the James-Lange theory, emotion is equivalent to the array of physiological arousal resulting due to external incidents. The two scientists indicated that for someone to feel emotion, he or she must first encounter with bodily responses like increased heart rate, increased respiration, or sweaty hands.  

Once this physiological reaction is determined, then the individual can suggest that he or she is feeling the emotions. This is in contrast to the general common-sense way of thinking regarding the cause and effect association between the experience of emotion and its expression.  

4 0
3 years ago
Other questions:
  • What are two reasons that a population of herbivores might decline in an ecosystem
    12·1 answer
  • How can you<br> find a food chain<br> within a food<br> web?
    11·1 answer
  • I NEED HELP WITH THIS ASAP!!
    9·1 answer
  • A person has a sex-linked inheritable disease. Which statement is true about the set of chromosomes which are likely to carry th
    12·2 answers
  • Which of the following best explains the difference between dominant and recessive traits? A. Dominant traits always appear, eve
    14·1 answer
  • A jockey feeds a carrot to his horse first thing in every morning. The horse now "neighs" every morning when it sees the jockey.
    15·2 answers
  • Animals and other ____________ rely on ____________ that carry out photosynthesis.
    6·1 answer
  • Which of the following best explains how a biotic factor can control the population of a species in an ecosystem? A sudden drop
    7·1 answer
  • Cervical dysplasia is the presence of __________ in the cells that make up the inner lining of the cervix.
    10·1 answer
  • Cylindrical bacterial cells are called , whereas gently curved cylindrical cells are referred to as .:_________
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!