Answer:
The correct option is number 3. A deficit of appositional bone growth would not be life threatening.
Explanation:
Appositional bone growth can be defined as the thickening of the bones due to increase in the number of bone tissues at the surface. In this kind of bone growth, the diameter of the bone increases rather than the length of the bone. This can lead to deformation of the bone but it is not life-threatening.
Rest of the options 1, 2 and 3 are serious disorders and can eventually lead to death.
Carbohydrates dissolve in water and lipids don't. Explain how the bonding properties of carbon atoms result in the large variety of carbon-based molecules in living things<span>. </span>Carbon atoms<span> are able to form 4 </span>types<span> of covalent bond which ends up as molecules</span><span>.</span>
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Prokaryotes have a nucleus, Eukaryotes don't
Explanation:
(see image)
