1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
12

1. The body has different types of defences against pathogens.

Biology
1 answer:
lara [203]3 years ago
6 0
2and3 only are the defense
You might be interested in
Name two types of cells that would be destroyed by apoptosis
schepotkina [342]

Answer:

Apollo and Ikollo

Explanation:

The cell will be exposed to The outer brain making it vulnerable to attack

8 0
4 years ago
I need help labeling this diagram please
KIM [24]
Answer:
1. Cell membrane
2. Cytoplasm
3. DNA
4. Nuclear membrane
5. Transcription from DNA template
6. mRNA
7. Nuclear pore complex
8. tRNA
9. Amino acid
10. Ribosome
6 0
3 years ago
I need to know the answer it’s a one answer question.
Viktor [21]

Answer: D

Explanation: Canada geese are native to north america and breed in Canada.

8 0
3 years ago
What are the top 3 biological study’s
vodomira [7]
Plants, microorganisms, and animals
7 0
3 years ago
It was discovered by Alexander Fleming in the 1920's that Penicillium notatum produced a substance, know as penicillin, which ha
Stolb23 [73]

Answer: (B) Fungi

Explanation:

<u>Penicillium notatum is a species of fungus</u> in the genus Penicillium. It is common in temperate and subtropical regions and can be found on salted food products, but it is mostly found in indoor environments, especially in damp or water-damaged buildings.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Researchers use fluorescent labels and light microscopy to
    11·1 answer
  • ANSWER THIS! 45 POINTS! OMGGG
    9·1 answer
  • A blank is a species that naturally lives in an ecosystem
    9·1 answer
  • What is produced when a yeast cell undergoes fermentation?
    5·2 answers
  • Cohesion describes water's _____.
    14·2 answers
  • Which of the following describes prokarotes
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why is alchemy no longer accepted?
    9·2 answers
  • HURRY please!!
    5·1 answer
  • The list shows some of the livestock being raised in South Dakota.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!