1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexira [117]
3 years ago
13

Pls i need an example of an stimuli and response pls

Biology
2 answers:
mash [69]3 years ago
7 0
Examples of stimuli are the weather, sound, the cold, light, taste, color, and gravity. 

- When you hear a loud noise you get scared and scream
- When it is hot outside you sweat
cluponka [151]3 years ago
7 0
<span>Stimulus is any change in an organisms environment that causes the organism to react. Basically a fancy way of saying cause. For example: if an animal is cold it moves into the sun.

Stimulus - temperature
Response - moves to finds the heat</span>
You might be interested in
Blood is composed of many tiny cells in a liquid called plasma. Blood is actually considered a colloid. The dispersed state of m
Ulleksa [173]
The dispersed state of matter is a solid and the dispersion medium is a liquid.
3 0
3 years ago
Read 2 more answers
How could a scientist use the scientific method to learn more about the Cretaceous era?
Alina [70]

First, it is necessary that this scientist decide on what point of the Cretaceous period he wants to study. Among several points he may want to study the evolution of microorganisms of that time, the life of a dinosaur species, or the evolution of dinosaurs, the flora that was established during this period, among others. This is the phase of the scientific method called Observation.

After that, he must enter the phase called "Elaboration of hypotheses" where he will raise questions about the point he decided to study. "How many flower species existed in that period?", "How many of these flowers can we observe today?" among others.

After that, he will enter the phase called "Experimentation", where he will establish a type of experiment and all the experimental factors and variables that will allow the hypotheses to be answered.

After the experiment he will collect the data that will be analyzed and that will give results that will answer the hypotheses previously established. This is the phase called "Analysis of the results".

At that moment, he will be able to reach the last phase of the scientific method, the phase called "conclusion", where he will show the conclusions that the experiment allowed to be established.

5 0
3 years ago
Read 2 more answers
Oxygen and CO2 are exchanged between capillaries and alveolus. Do capillaries contain deoxygenated blood while alveolous contain
dalvyx [7]
The aveolus is surrounded by capillaries. So capillaries carry deoxygenated blood to the alveolus where the oxygen from the alveolus diffuses into the blood in the capillaries. The deoxygenated blood is now oxygenated and is carried out of the lung via capillaries that then merge into the pulmonary vein.

In other words, alveolus does not have oxygenated blood it just puts oxygen into the deoxygenated blood hat this brought in.
4 0
2 years ago
Read 2 more answers
According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?
navik [9.2K]

Answer: Isaac

Explanation:

3 0
2 years ago
Individuals with one form of lactose intolerance do not produce the
Tema [17]

Answer: Transcription - A

Explanation:

This problem is talking about the lac operon and the gene expression of lac operon. If the gene is turned off, then transcription, the generation of mRNA won't occur.

6 0
2 years ago
Other questions:
  • Minerals come from organic materials.
    7·2 answers
  • There are four steps in bacterial conjugation. The second step is missing in this list.
    8·1 answer
  • What part of the brain stores stressful experiences as negative emotional memories?
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Explain why a hydrogen atom can become either an ion or part of a molecule
    14·1 answer
  • Which population is limited by a density- dependent factor?
    7·1 answer
  • How did Charles Darwin describe the process of natural selection
    7·1 answer
  • Which of the following is a function of the cerebellum?
    9·1 answer
  • *<br> What helps prevent bacteria from entering your lungs? *<br> HURRY!
    12·1 answer
  • What function do chloroplasts perform?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!