1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
15

With the current energy shortage, nuclear energy can been seen as: a hazard a solution A and B neither A nor B

Biology
2 answers:
DerKrebs [107]3 years ago
6 0

Answer: the correct and answer is C A and B

Explanation:

Free_Kalibri [48]3 years ago
4 0

The correct answer is - A and B.

The nuclear energy can been seen at either way, and that is why it has both its supporters and its critics.

The nuclear energy is cheaper, cleaner, and nuclear centrals can produce much more and much more efficiently as well, so it can easily be seen why it can be extremely useful in a world where the energy demand is ever-growing.

On the other side, there's a huge risk with the nuclear centrals because if there's some problem, it can all turn into a catastrophe that will affect huge area. The consequences of a nuclear reactor exploding or leaking are long term, and takes lot of time that the area can be used for anything. Lots of human lives can be lost, and affected for numerous generations, as well as destroying the natural environment in a brutal way.

You might be interested in
Which of the following changes to the crust can happen from the movement of Earth's plates? (multiple choice) A.glaciers carve h
MrRa [10]
E volcanoes are formed
7 0
2 years ago
What is the meaning of life as we know it?
Andrews [41]
Suicide is the only answer to this god for saken lifetime
7 0
3 years ago
In heterotrophs, energy for the life processes comes from the chemical energy stored in the bonds of
Delicious77 [7]
Humans get there energy primarily from glucose I believe. We break down glucose to get ATP (Adenosine Triphosphate) which is then used to supply energy to our cells in order to function. 
7 0
3 years ago
) Which of the following statements about transcriptional regulators is false? (a) Transcriptional regulators usually interact w
OverLord2011 [107]

The false statement is: (a) Transcriptional regulators usually interact with the sugar–phosphate backbone on the outside of the double helix to determine which DNA sequence to bind.

Transcriptional regulator or factor is protein with the ability to control and regulate gene expression at the transcription level by binding to DNA. Transcriptional factors have domain-DNA-binding domain which contains structural motif that recognizes DNA and it is responsible for the attachment to specific DNA sequence. It usually binds to the DNA major groove (hydrogen bonding) because it is less degenerate than that of the DNA minor groove.  

Transcriptional factors also contain trans-activating domain for the binding of other proteins and signal-sensing domain for the detection of external signals.

6 0
3 years ago
The ___________ propel debris-laden mucus away from lower respiratory system structures.
Aliun [14]

The cilia propel debris-laden mucus away from lower respiratory system structures.

<h3>What is function of mucous membrane?</h3>
  • Another general defense against possible infections is provided by the mucous membranes that line the digestive, urinary, and respiratory tracts, as well as the nose, mouth, and lungs.
  • In order to cover and protect the more delicate cell layers underneath it and to trap waste and particle matter, including microorganisms, mucous membranes are made up of a layer of epithelial cells connected by tight junctions.
  • Because they feature ciliated appendages, which resemble hairs, the epithelial cells lining the upper portions of the respiratory tract are known as ciliated epithelial cells.
  • Mucus that contains debris is forced out and away from the lungs by the cilia's movement. The mucus is then coughed up, sneezed out, or swallowed and destroyed in the stomach. The mucociliary escalator is another name for this route of elimination.

Learn more about the Mucous membrane with the help of the given link:

brainly.com/question/25968581

#SPJ4

8 0
2 years ago
Other questions:
  • Each gram of glucose contains approximately how much energy
    5·1 answer
  • Explain why all mutations are not necessarily harmful
    15·1 answer
  • Which property causes atomic particles to attract or repel each other
    5·1 answer
  • •In fruit flies, two wings (W) is dominant over four wings (w).
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • In the pedigree below, squares represent males and circles represent females. Individuals who express a particular trait are rep
    6·1 answer
  • In DNA replication, gaps between newly synthesized segments of DNA and existing segments of DNA are sealed by enzymes called ___
    14·1 answer
  • An unlabeled hierarchical diagram of various astronomical bodies is shown. The labels A, B, C and D can be used to represent the
    12·1 answer
  • Cell or Plasma membrane is composed of
    15·1 answer
  • Where in the cell does the citric acid cycle take place?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!