The answer is C. nitrogen.
Plants are main producers in ecosystems so, primary productivity of ecosystems depends on them. Carbon is necessary for plants, but it is widely present in plants. On the other hand, calcium and sodium are not as essential. However, nitrogen is important for plants because it is necessary to make proteins. Proteins take part in many different processes such as photosynthesis (this is actually primary productivity). But, nitrogen is not available to plants, they cannot absorb it simply from the air but rely on some symbiotic bacteria which are able to.
The water molecules labeled A in Figure 4.1 are going to the thylakoids to take part in Light-Dependent Reactions.
The interior membrane structure of the chloroplast is composed of interconnecting disc-like sacs called thylakoids. They are discovered floating in the stroma. Grana are stacks of thylakoids that are arranged in a particular way. The thylakoid membrane contains chlorophyll, a photosynthetic pigment that absorbs light during photosynthesis.
The interior membranes of cyanobacteria and chloroplasts, known as thylakoids, serve as a platform for the photochemical reactions that take place during photosynthesis.
to know more about thylakoids visit
brainly.com/question/13050631
#SPJ4
1. the hearts job is to propel blood throughout the body
2. i think the lungs trade CO2 for O2
3. they would go into hypothermic shock or something:p
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Escuse me but whats the question
