1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
3 years ago
9

Enzymes function most efficiently at the temperature of a typical cell, which is 37

Biology
1 answer:
Dvinal [7]3 years ago
8 0

Answer:

I believe the warmer the heat is the molecules will speed up and the cooler the molecules are the slower it'll be

You might be interested in
What is NOT true about energy transformation in living things?
Eduardwww [97]
I say that it is D well i think it's D
5 0
3 years ago
A scientist observes a pair of separate chromosomes that have genes for the same trait arranged in the same order. However, some
andre [41]

The correct answer is A. Homologous chromosomes with heterozygous alleles.

If the alleles of genes are different then the scientist is observing for homologous chromosomes with heterozygous alleles.

In each homologous pair there is one chromosome which comes from maternal chromosome and the other one from paternal chromosome.

Homologous chromosomes are not identical but they are similar. Alleles for each homologous chromosome is not same but genes are the same.

5 0
4 years ago
Read 2 more answers
What describes a country with less industry and whose citizens have low average incomes.
ICE Princess25 [194]

third world countries

Explanation:

are the results of countries with low exports and high imports

7 0
3 years ago
Read 2 more answers
-
Andru [333]

Answer:

C. Both (a) and (b)

Explanation:

Hunting, destroying habitats, polluting and introducing non-native species can cause extinction.

7 0
3 years ago
Read 2 more answers
Which statement accurately describes a La Niña event?
mixas84 [53]

La Niña has the opposite effect than does an El Niño event. La Niña is a climate pattern that describes the cooling of surface ocean waters. It is considered to be the counterpart to El Nino, which is characterized by unusually warm ocean temperatures in the equatorial region of the Pacific Ocean.

4 0
4 years ago
Read 2 more answers
Other questions:
  • The picture shows a fishing technique called trawling. How might trawling affect marine biodiversity
    5·2 answers
  • What is the purpose of a coliform count on water?
    8·1 answer
  • How does warm temperature compared to cold temperature affect enzyme reaction rates?
    10·1 answer
  • Which term describes the chromosomal abnormality of having three copies of a single chromosome?
    7·2 answers
  • What food class is salt,oranges,butter,beverages,yoghurt,milk​
    11·2 answers
  • A human body cell has 46 chromosomes. Which diagram represents mitosis in a human body cell?
    15·2 answers
  • Can someone help me out please?!!!!!!!!
    8·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What are perlemoen used for?​
    10·1 answer
  • PLS HELP!!!!!!!
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!