Kill bugs.......................
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
e
Explanation:
Forests and trees store carbon . When they are degraded or completely cleared, e.g. by fire – a process referred to as deforestation – this stored carbon has the potential to be released back into the atmosphere as carbon dioxide and contribute to climate change .
Answer:
transfer of genes between populations, as in migration, or between species, in horizontal gene transfer. Evolution occurs when these heritable differences become more common or rare in a population, either non-randomly through natural selection or randomly through genetic drift.
