1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gladu [14]
3 years ago
13

The trp and lac operons are regulated in various ways. How do bacteria regulate transcription of these operons? Sort the stateme

nts into the appropriate bins depending on whether or not each operon would be transcribed under the stated conditions. View Available Hint(s)
Biology
1 answer:
irina1246 [14]3 years ago
5 0

Hint:lac operon: lactose absent

lac operon: lactose and glucose present

lac operon: lactose present, glucose not

trp operon: tryptophan present

trp operon: tryptophan absent

Answer:

The operon is transcribed when:

Lac operon: lactose present, glucose not

The operon will not be transcribed if

lac operon: lactose absent

trp operon: tryptophan present

Operon is transcribed, but slowed through positive control:

Lac operon: lactose and glucose present

Trp operon: tryptophan absent

Explanation:

The lac operon is controlled by two factors one that acts positively through CAP-cAMP complex and the second that acts negatively through lac repressor that antagonizes binding of RNA polymerase to the promoter.

Negative control:

1.When lactose is absent, the repressor molecule bind the operator site of the lac gene and transcription is turned off.

2. In the presence of lactose, lactose binds to the repressor molecule, the repressor-lactose complex is inactive, the repressor protein does not bind to the operator, and transcription is turned on.

-Positive control:

The lac operon is also regulated by catabolite activator protein (CAP). When glucose is absent, bacteria accumulate cAMP. Bacteria RNA polymerase can only attach to the promoter site when CAP binds cAMP to form CAP-cAMP, hence CAP is a positive regulator.

The trp operon is regulated through negative control mechanism only. When tryptophan is present, the operon genes are not transcribed.

You might be interested in
Will give 15 Points
I am Lyosha [343]

Answer:

based on the graph the most common gas in the atmosphere would be nitrogen

3 0
2 years ago
Which of the following is a source of genetic variation in sexually-reproducing organisms? A. meiosis B. translation C. mitosis
Alenkasestr [34]

The answer is A. meiosis

6 0
3 years ago
Read 2 more answers
What is colocalization in protein protein interaction?
tatuchka [14]
That is part of a cow when it has ate something with cocoa.
4 0
3 years ago
Which vitamin can be synthesized in significant amounts by humans and, therefore, may NOT be essential
Nadya [2.5K]

Answer:

The correct ansqwer is- Vitamin D

Explanation:

Vitamin D is the vitamin that can be synthesized by the human body itself therefore it is not an essential vitamin for human beings. Human skin is the part that helps in making this vitamin in humans.

The natural form of vitamin D is vitamin D3 which is formed by the sunlight exposure on the skin. When we expose our skin in the sunlight the UV radiation penetrated our skin and converts provitamin D3 into pre-vitamin D3 then this previtamin can be isomerized into the natural form of vitamin D Which is vitamin D3. So the right answer is vitamin D.

5 0
3 years ago
In humans and other mammals, dosage compensation is achieved by
Dmitriy789 [7]
I believe its when you <span>silencing one of the two X chromosomes in female cells...

Hope I helped

</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • DNA copies itself during which phase?<br><br> G1<br><br> G2<br><br> S<br><br> cytokinesis
    13·1 answer
  • Which represents the most accepted form of scientific ideas
    14·1 answer
  • Only a living organism exhibits all the characters of Life true or false
    5·1 answer
  • What does it mean when a population’s growth becomes steadily less until it stops growing and stays at a steady size?
    7·1 answer
  • Each element on the periodic table is represented by a:
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • In a cross of purple flowered heterozygous plants (Pp), the letter P represents the allele for purple flowers and the letter p r
    7·1 answer
  • Eggs and sperm are called gametes. What problem would result if gametes were diploid?​
    10·2 answers
  • What happens to mRNA after transcription ?
    12·2 answers
  • Why do sex-linked traits follow different patterns of inheritance than other traits ?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!