1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
8

Each row in the auditorium has 18 seats and 246 and teachers are going to watch an assembly in the auditorium how many rows of s

eats will be completely filled​
Biology
1 answer:
Romashka-Z-Leto [24]3 years ago
3 0

13

Explanation:

We will divide the total number of the teachers (246) in the auditorium with the maximum number of seats per row (18) to determine how many rows are completely filled;

246/ 18  = 13.6667

We are only interested in rows that are completely filled which is the whole number;

= 13

Learn More:

brainly.com/question/13235411

brainly.com/question/2352952

#LearnWithBrainly

You might be interested in
Name the three types of population distribution, describe each, and explain the conditions that govern each.
tankabanditka [31]

Answer: Population distributions may be described as <em>random, uniform</em><em> or </em><em>clustered.</em>

Explanation:

In a specified region, a population comprises any  number of members of the same species. Populations are described by sizes- the number of individuals; densities-  individuals in a set space (per unit area); and distribution- the dispersal or non dispersal of individuals (spread out or clumped). Population distributions may be described in three ways:

  • Random: the distribution pattern is haphazard, with no regular spacing; individuals grow independently of each other without competing and resources are consistent. <em>E.g. dandelion seed dispersal by wind </em>

  • Uniform:  individuals are evenly spaced in a predictable pattern; there may be some interaction and ideally, spaces between them  are maximized in order to ensure access to limited nutrients and resources.<em> E.g.  human farming- cornfields, orchards; allelopathy in plants like purple sage, which secretes chemicals to prevent the growth of other plants nearby</em>

  • Clumped: there is less distance between neighboring organisms and these individuals cluster together. This pattern is most common in environments where resources are scarce, or the species is dependent on social interactions.<em> E.g. lions are highly social and hunt in prides in the wild</em>

6 0
3 years ago
Read 2 more answers
I need help lol i dont get it
Lyrx [107]
D! The Cell membrane in found in all cells, and it is a single (mono) layer.


6 0
3 years ago
If anyone can help with any of these I would greatly appreciate it ;-; its due in about an hour
solniwko [45]

Answer:

Like ur carpet.

3 0
3 years ago
I have 4 questions:
Degger [83]
Yes there is an equation that can change carbon dioxide to oxygen
5 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Other questions:
  • Which part of the heart takes blood from the veins and pumps it into a ventricle?
    7·1 answer
  • List five observations Darwin made about the Amblyrhynchus lizards.
    15·1 answer
  • What nutrient does your body need to help move food through your digestive system?
    14·1 answer
  • Which organism has the lowest biotic potential?
    10·1 answer
  • What component is necessary to identify plants that integrate a transgendered
    12·1 answer
  • What limits cell division?
    5·2 answers
  • While on an archaeology expedition, you unearth a skeleton with the following characteristics: four long, slender finger bones a
    8·1 answer
  • Which causes natural selection to occur?
    14·1 answer
  • Some people see hydroelectric energy, energy harnessed from water movement, as a clean alternative to fossil fuels. Others belie
    15·1 answer
  • What are chromoplasts and their functions? ​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!