Answer: Population distributions may be described as <em>random, uniform</em><em> or </em><em>clustered.</em>
Explanation:
In a specified region, a population comprises any number of members of the same species. Populations are described by sizes- the number of individuals; densities- individuals in a set space (per unit area); and distribution- the dispersal or non dispersal of individuals (spread out or clumped). Population distributions may be described in three ways:
- Random: the distribution pattern is haphazard, with no regular spacing; individuals grow independently of each other without competing and resources are consistent. <em>E.g. dandelion seed dispersal by wind </em>
- Uniform: individuals are evenly spaced in a predictable pattern; there may be some interaction and ideally, spaces between them are maximized in order to ensure access to limited nutrients and resources.<em> E.g. human farming- cornfields, orchards; allelopathy in plants like purple sage, which secretes chemicals to prevent the growth of other plants nearby</em>
- Clumped: there is less distance between neighboring organisms and these individuals cluster together. This pattern is most common in environments where resources are scarce, or the species is dependent on social interactions.<em> E.g. lions are highly social and hunt in prides in the wild</em>
D! The Cell membrane in found in all cells, and it is a single (mono) layer.
Yes there is an equation that can change carbon dioxide to oxygen
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.