1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
4 years ago
6

How can energy and matter be cycled without oxygen?

Biology
1 answer:
irina [24]4 years ago
7 0

Producers, which are the base of the food chain for ecosystems are essential and do not require oxygen to cycle energy and matter, as they create oxygen through photosynthesis.  Plants are producers that use this process to capture light energy and use it to convert carbon dioxide and water into an organic substance known as glucose.

You might be interested in
What is the difference between Density Dependent and Independent Factors?
Ne4ueva [31]
Density dependent factors are those that regulate the growth of a population depending on its density while density independent factors are those that regulate population growth without depending on its density
4 0
4 years ago
What type of data does an an EKG AND ITS importance in understanding the health of the heart.
olganol [36]

Answer:

Each time your heart beats, an electrical signal travels through the heart. An EKG can show if your heart is beating at a normal rate and strength. It also helps show the size and position of your heart's chambers. An abnormal EKG can be a sign of heart disease or damage.

7 0
3 years ago
The honey comb like appearance of this sand stone is the result of?
wel

Answer:

The honeycomb-like appearance of this sandstone is a result of frost wedging. The honeycomb-like appearance of this sandstone is a result of frost wedging

Explanation:

4 0
4 years ago
Read 2 more answers
Changes in traits in a population due to evolution are called...
ahrayia [7]
The answer is adaptations
6 0
3 years ago
Why coal is not commonly used?
dimaraw [331]

Answer:

One reason, it causes global warming

Explanation:

It is a major source of carbon dioxide when it burns.Furthermore, the ash coal produces makes it impossible to get things clean.

4 0
3 years ago
Other questions:
  • After Birth , the two periods of most rapid growth are
    5·1 answer
  • Read the excerpt from "Mother Tongue." Those tests were constructed around items like fill-in-the-blank sentence completion, suc
    8·2 answers
  • Describe where cartilage is found on a long bone
    10·1 answer
  • What is life? Describe attributes of life that make it distinctive from other parts of the Earth system, such as minerals, water
    9·1 answer
  • What is the type of cellular respiration that uses oxygen to produce large amounts of energy called?
    5·2 answers
  • A scientist thinks that a certain chemical is a mutagen. She exposes plant cells to a large amount of this chemical in the labor
    7·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Plzzzzz help
    6·1 answer
  • Please please help me i will give brainliest
    15·1 answer
  • Which sequence below correctly illustrates the order in which proteins are synthesized? Question 5 options: RNA--> DNA -->
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!